ID: 967757250

View in Genome Browser
Species Human (GRCh38)
Location 3:193183922-193183944
Sequence TCCTATCCATGTGCATAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967757250_967757252 8 Left 967757250 3:193183922-193183944 CCATTTTATGCACATGGATAGGA No data
Right 967757252 3:193183953-193183975 GAAAATGGCCATACTGTCCAAGG 0: 199
1: 9792
2: 3221
3: 916
4: 416
967757250_967757251 -7 Left 967757250 3:193183922-193183944 CCATTTTATGCACATGGATAGGA No data
Right 967757251 3:193183938-193183960 GATAGGAAAAATCATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967757250 Original CRISPR TCCTATCCATGTGCATAAAA TGG (reversed) Intergenic
No off target data available for this crispr