ID: 967757531

View in Genome Browser
Species Human (GRCh38)
Location 3:193186900-193186922
Sequence CTCAAAAGAAAGTCGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967757531_967757537 -1 Left 967757531 3:193186900-193186922 CCCTTTCCCGACTTTCTTTTGAG No data
Right 967757537 3:193186922-193186944 GAACCCAGGCATATGGTTCTTGG No data
967757531_967757536 -8 Left 967757531 3:193186900-193186922 CCCTTTCCCGACTTTCTTTTGAG No data
Right 967757536 3:193186915-193186937 CTTTTGAGAACCCAGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967757531 Original CRISPR CTCAAAAGAAAGTCGGGAAA GGG (reversed) Intergenic
No off target data available for this crispr