ID: 967761107

View in Genome Browser
Species Human (GRCh38)
Location 3:193227274-193227296
Sequence TGAATCCCAGGTTGCCACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967761107_967761112 29 Left 967761107 3:193227274-193227296 CCTGCGTGGCAACCTGGGATTCA No data
Right 967761112 3:193227326-193227348 ACTCTATCTCACTTTGCTGATGG No data
967761107_967761110 6 Left 967761107 3:193227274-193227296 CCTGCGTGGCAACCTGGGATTCA No data
Right 967761110 3:193227303-193227325 GAGGTGAGAAACCTGCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967761107 Original CRISPR TGAATCCCAGGTTGCCACGC AGG (reversed) Intergenic