ID: 967761110

View in Genome Browser
Species Human (GRCh38)
Location 3:193227303-193227325
Sequence GAGGTGAGAAACCTGCTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967761107_967761110 6 Left 967761107 3:193227274-193227296 CCTGCGTGGCAACCTGGGATTCA No data
Right 967761110 3:193227303-193227325 GAGGTGAGAAACCTGCTAGCAGG No data
967761101_967761110 22 Left 967761101 3:193227258-193227280 CCTGGCCTCTCCTGTTCCTGCGT No data
Right 967761110 3:193227303-193227325 GAGGTGAGAAACCTGCTAGCAGG No data
967761103_967761110 17 Left 967761103 3:193227263-193227285 CCTCTCCTGTTCCTGCGTGGCAA No data
Right 967761110 3:193227303-193227325 GAGGTGAGAAACCTGCTAGCAGG No data
967761104_967761110 12 Left 967761104 3:193227268-193227290 CCTGTTCCTGCGTGGCAACCTGG No data
Right 967761110 3:193227303-193227325 GAGGTGAGAAACCTGCTAGCAGG No data
967761109_967761110 -6 Left 967761109 3:193227286-193227308 CCTGGGATTCAATCTGTGAGGTG No data
Right 967761110 3:193227303-193227325 GAGGTGAGAAACCTGCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967761110 Original CRISPR GAGGTGAGAAACCTGCTAGC AGG Intergenic