ID: 967761914

View in Genome Browser
Species Human (GRCh38)
Location 3:193235340-193235362
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967761914_967761920 -8 Left 967761914 3:193235340-193235362 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 967761920 3:193235355-193235377 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967761914 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr