ID: 967765319

View in Genome Browser
Species Human (GRCh38)
Location 3:193272583-193272605
Sequence TGTAGTAATTCCCCTGCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967765319_967765323 -5 Left 967765319 3:193272583-193272605 CCCGAAGCAGGGGAATTACTACA 0: 1
1: 0
2: 1
3: 14
4: 281
Right 967765323 3:193272601-193272623 CTACACCCACCAGTGGGAGAAGG 0: 1
1: 0
2: 0
3: 20
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967765319 Original CRISPR TGTAGTAATTCCCCTGCTTC GGG (reversed) Intronic
900651659 1:3732809-3732831 TGTAGTCGTGGCCCTGCTTCAGG - Exonic
901696480 1:11011913-11011935 TCAAGCAATTCTCCTGCTTCAGG + Intergenic
902523546 1:17037834-17037856 TCAAGCAATTCTCCTGCTTCAGG + Intronic
904309666 1:29620693-29620715 AGAAGTAATTACCCTACTTCTGG - Intergenic
904938627 1:34149487-34149509 TGTACTAATTCCCATTATTCTGG - Intronic
909654403 1:78014698-78014720 TCAAGTAATTCTCCTGCCTCAGG + Intronic
909929368 1:81477801-81477823 TTTAGTGATTCAGCTGCTTCAGG + Intronic
910213253 1:84815637-84815659 TGAAGTAATTCCCATAATTCGGG - Intronic
912211757 1:107564223-107564245 TGAAGCAATTCTCCTGCCTCAGG - Intergenic
913693297 1:121300195-121300217 TGTAGAAATTACCCAGCCTCAGG - Intronic
917983765 1:180293992-180294014 TCAAGTGATTCTCCTGCTTCAGG + Intronic
918199060 1:182249770-182249792 TCTAGCAATTCTCCTGCCTCAGG - Intergenic
919049402 1:192494806-192494828 TCCAGTGATTCTCCTGCTTCAGG - Intergenic
920157487 1:203966663-203966685 TCAAGCAATTCCCCTGCCTCAGG - Intergenic
920998953 1:211023183-211023205 TGTAATAATTCCCCTTCATCTGG - Intronic
922862957 1:228835063-228835085 TGTATAAATTTCCCAGCTTCAGG - Intergenic
922869112 1:228885825-228885847 TCAAGCAATTCTCCTGCTTCAGG - Intergenic
923667155 1:236008764-236008786 TCAAGTGATTCTCCTGCTTCAGG + Intronic
923950268 1:238943779-238943801 TGTAGTATTTCCTATGCTCCAGG - Intergenic
1063145921 10:3295053-3295075 TCAAGTGATTCCCCTGCCTCAGG - Intergenic
1063173232 10:3528734-3528756 TCAAGTGATTCCCCTGCCTCAGG + Intergenic
1063407295 10:5808574-5808596 TCAAGTAATTCTCCTGCCTCAGG - Intronic
1063578932 10:7287755-7287777 TGTAGTAATTCCACTGCTTTAGG - Intronic
1063918246 10:10905969-10905991 TGAAGCAATTCTCCTGCCTCAGG - Intergenic
1064079557 10:12297363-12297385 TCAAGCAATTCTCCTGCTTCAGG - Intergenic
1065172749 10:23048409-23048431 TCAAGCAATTCCCCTGCCTCAGG - Intergenic
1065890819 10:30119639-30119661 TCTAGCAATTCTCCTGCCTCAGG + Intergenic
1066388796 10:34962529-34962551 TCAAGCAATTCTCCTGCTTCAGG + Intergenic
1066551671 10:36565278-36565300 TTAAGCAATTCTCCTGCTTCAGG + Intergenic
1066604569 10:37148644-37148666 TCTAGTAAGACTCCTGCTTCTGG - Intronic
1067106694 10:43371351-43371373 TCAAGCAATTCCCCTGCCTCAGG - Intergenic
1068625439 10:59241542-59241564 TGTAGGAATTCCTCTACCTCTGG + Intronic
1068697054 10:59979186-59979208 TCCAGCAATTCTCCTGCTTCAGG + Intergenic
1070211834 10:74331581-74331603 TCAAGTGATTCTCCTGCTTCAGG + Intronic
1070287342 10:75093471-75093493 TCAAGTGATTCTCCTGCTTCAGG - Intergenic
1070531062 10:77337942-77337964 TGTACTGAAACCCCTGCTTCTGG - Intronic
1076170738 10:128317642-128317664 TATAGGAATTCCCCACCTTCTGG - Intergenic
1078270394 11:9789291-9789313 TGTAGTAATCCCACTTCTTGAGG + Exonic
1079233363 11:18669044-18669066 TCAAGTGATTCCCCTGCCTCAGG - Intergenic
1080858417 11:36131961-36131983 TGTTGGATTTCCCCTGCTTGGGG + Intronic
1081761512 11:45579753-45579775 TGTATAAATTACCCTGCCTCGGG - Intergenic
1084373918 11:68763446-68763468 TGGAGCAATTCCACTGCGTCTGG + Intronic
1087522837 11:99264501-99264523 TGTAGCATTTCCCCTGCTCCAGG - Intronic
1088297669 11:108318260-108318282 TCTAGCAATTCTCCTGCCTCAGG - Intronic
1088450809 11:109979323-109979345 TCAAGTAATTCTCCTGCTTCAGG - Intergenic
1089156014 11:116403140-116403162 TGTAATAATTACCCTGATACTGG - Intergenic
1090009479 11:123033498-123033520 TCAAGTGATTCCCCTGCCTCAGG - Intergenic
1090444360 11:126750667-126750689 TTTAGTGGTTCCCCAGCTTCTGG + Intronic
1091960843 12:4692846-4692868 TTTATTAATTACCCAGCTTCAGG - Exonic
1093499510 12:19796287-19796309 TCAAGCAATTCCCCTGCCTCAGG + Intergenic
1094160803 12:27388244-27388266 TGTAGGGATTCCCATGATTCAGG + Intronic
1094651616 12:32384101-32384123 TGTAGTAAATCAGCTGCTTTGGG + Intergenic
1096058465 12:48675800-48675822 TGTACTAATTCCCCTTGCTCTGG + Intronic
1096145866 12:49278229-49278251 TGAAGTGATTCTCCTGCCTCAGG + Intergenic
1096314756 12:50554865-50554887 TCAAGTGATTCCCCTGCCTCAGG + Intronic
1096371915 12:51075949-51075971 TCAAGTGATTCTCCTGCTTCAGG - Intronic
1096780878 12:53991465-53991487 TGGAGCTATTCCCCTGCATCTGG - Intronic
1098712429 12:73780161-73780183 TGTTGTAATTTCCCTTTTTCAGG + Intergenic
1099147596 12:79066235-79066257 TGTGGTGTTTACCCTGCTTCTGG - Intronic
1099452560 12:82824987-82825009 TCAAGTGATTCCCCTGCCTCAGG - Intronic
1099504198 12:83451863-83451885 TGTAGTGACTACCCTGCTTTTGG - Intergenic
1099736014 12:86567002-86567024 TGTATTAATCCAGCTGCTTCAGG - Intronic
1101091801 12:101294640-101294662 TCAAGTGATTCTCCTGCTTCAGG + Intronic
1102305739 12:111803361-111803383 TCAAGTAATTCTCCTGCCTCAGG - Intronic
1102368245 12:112358379-112358401 TGAAGTGATCCCCCTGCTTCGGG - Intronic
1102481053 12:113223641-113223663 TCAAGTGATTCTCCTGCTTCAGG + Intronic
1103099750 12:118163348-118163370 TATAGTAATTTCCCTGGTTTTGG + Intronic
1103624768 12:122209563-122209585 TCAAGCAATTCTCCTGCTTCAGG - Intronic
1106630152 13:31463325-31463347 TCAAGTGATTCCCCTGCCTCAGG + Intergenic
1109862032 13:68212361-68212383 CAAAGTAATTCCCTTGCTTCAGG + Intergenic
1111553571 13:89849561-89849583 TGTAGTAATCCCCATGTGTCAGG - Intergenic
1112122285 13:96426151-96426173 TGCTGTAAGACCCCTGCTTCAGG + Intronic
1112195730 13:97224334-97224356 TATTGTACTTCCCCTGCTTGGGG - Intronic
1112481949 13:99784416-99784438 TTTTGTTATTCCTCTGCTTCTGG + Intronic
1112514108 13:100037170-100037192 TAAAGCAATTCTCCTGCTTCAGG + Intergenic
1116196401 14:41732319-41732341 TGTTGTAAGTCTTCTGCTTCTGG + Intronic
1116256694 14:42566068-42566090 TGTAGTGATGCCCCTTCTTTTGG + Intergenic
1116442516 14:44969249-44969271 TCAAGTAATTCTCCTGCCTCAGG + Intronic
1116915075 14:50517249-50517271 TGAAGCAATTCTCCTGCCTCAGG + Intronic
1116969825 14:51052399-51052421 TGTAGGAATTCCTCTTCTCCTGG + Intronic
1117516177 14:56504059-56504081 TCAAGTGATTCCCCTGCCTCAGG + Intronic
1119087364 14:71750679-71750701 TGAAGCACTTCCCATGCTTCTGG + Intergenic
1126581474 15:50246138-50246160 GGGAGTAATTGCCCTGCTTGAGG - Intronic
1126631914 15:50745248-50745270 TCAAGTGATTCTCCTGCTTCAGG + Intronic
1127410086 15:58697199-58697221 TGTAGTAGCTCCACTGCTTGGGG - Intronic
1129448109 15:75633068-75633090 TCTAGCAATTCTCCTGCCTCAGG + Intergenic
1130314444 15:82783196-82783218 TAAAGTGATTCTCCTGCTTCAGG + Intronic
1132479837 16:161501-161523 TCTAGTAATTCCCCTTCTAGAGG + Intronic
1132984908 16:2760347-2760369 CGAAGTCCTTCCCCTGCTTCAGG + Exonic
1133963129 16:10511606-10511628 TCAAGTAATTCTCCTGCCTCAGG - Intergenic
1134086441 16:11360556-11360578 TCAAGTGATTCCCCTGCCTCAGG - Intronic
1134400070 16:13901631-13901653 TCTAGTGATTCTCCTGCCTCAGG - Intergenic
1134768784 16:16785738-16785760 TTTATAAATTCCCCAGCTTCAGG + Intergenic
1135523325 16:23194192-23194214 TATAGCAATTCCCATGCATCGGG - Exonic
1135690902 16:24536820-24536842 TCAAGTAATCCTCCTGCTTCAGG - Intergenic
1137414010 16:48255636-48255658 TGTAATAATTCCCATGTGTCAGG + Intronic
1137472738 16:48776400-48776422 TTTATTAATTACCCAGCTTCAGG + Intergenic
1138131121 16:54480965-54480987 TCAAGTGATTCTCCTGCTTCAGG + Intergenic
1138998869 16:62484573-62484595 TCTAGTAATTCCCCTTCTCCAGG + Intergenic
1139330675 16:66187402-66187424 TGGTGTAATTCTCCTACTTCTGG + Intergenic
1139473873 16:67192784-67192806 TGTCGTAAATCCGCCGCTTCTGG - Exonic
1139897225 16:70297310-70297332 TCTAGTGATTCTCCTGCCTCAGG + Intronic
1140572076 16:76119174-76119196 TCAAGCAATTCTCCTGCTTCAGG + Intergenic
1141257617 16:82417350-82417372 TGTAATTATTTCCCTGCATCAGG + Intergenic
1141937782 16:87253317-87253339 TCAAGCAATTCTCCTGCTTCAGG - Intronic
1143111033 17:4552931-4552953 TGAAGCAATTCTCCTGCCTCAGG + Intronic
1144340540 17:14306174-14306196 TGTAGTAACTATCCTGCTTGGGG - Intronic
1146372447 17:32273833-32273855 TCAAGTCATTCTCCTGCTTCAGG + Intronic
1148031317 17:44623049-44623071 TCAAGTGATTCCCCTGCCTCAGG - Intergenic
1148113089 17:45158033-45158055 TACAGTAATTCCCCCTCTTCGGG - Intergenic
1148376752 17:47155195-47155217 TTTAGTAGTTCCCCGGCCTCAGG + Intronic
1148425916 17:47595880-47595902 TCAAGCAATTCTCCTGCTTCAGG - Intronic
1149766594 17:59284003-59284025 TCAAGCAATTCTCCTGCTTCAGG - Intergenic
1149802365 17:59581657-59581679 TCAAGTAATTCTCCTGCCTCAGG - Intronic
1149844127 17:59993833-59993855 TCAAGTAATTCTCCTGCCTCAGG + Intergenic
1150485553 17:65540974-65540996 TCAAGTGATTCCCCTGCCTCAGG + Intronic
1151907299 17:77056819-77056841 TTAAGTAATCCTCCTGCTTCAGG - Intergenic
1153746631 18:8186224-8186246 TCTAGTGATTCTCCTGCCTCAGG - Intronic
1154482194 18:14841821-14841843 TCTAGTAATCCTCCCGCTTCCGG - Intronic
1155043049 18:22081175-22081197 TGAAGCAATTCTCCTGCCTCAGG - Intergenic
1158162162 18:54497259-54497281 TGAGGTAATGCCCCTGCTTGGGG + Intergenic
1159406748 18:68012703-68012725 TCAAGTAATTCATCTGCTTCAGG + Intergenic
1161317311 19:3623634-3623656 TGTAGCATTTCCACTGTTTCTGG - Intronic
1161877957 19:6926467-6926489 TGAAGTAATTCACCACCTTCAGG - Exonic
1162928100 19:13940469-13940491 TCTAGTGATTCTCCTGCCTCAGG - Intronic
1163135610 19:15308913-15308935 TGAAGCAATTCTCCTGCCTCAGG - Intronic
1163352851 19:16789815-16789837 TGAAGTGATTCTCCTGCCTCAGG + Intronic
1164004888 19:21139427-21139449 TTCAGCAATTCTCCTGCTTCAGG - Intergenic
1164312109 19:24055101-24055123 TGAAGCAATTCTCCTGCCTCAGG - Intronic
1165030029 19:32991357-32991379 TCAAGTAATTCTCCTGCCTCAGG - Intronic
1166153161 19:40889579-40889601 CGTAGAATTTCCACTGCTTCTGG + Intronic
1167135785 19:47614515-47614537 TCAAGCAATTCCCCTGCCTCAGG - Intronic
1167930808 19:52862932-52862954 TCAAGCAATTCCCCTGCCTCAGG - Intergenic
925809562 2:7685817-7685839 TGTAGTAACTTCCCTCCTTGAGG - Intergenic
926163920 2:10506285-10506307 TCAAGTAATTCTCCTGCCTCAGG - Intergenic
926650293 2:15336628-15336650 TCAAGCAATTCTCCTGCTTCAGG - Intronic
927791593 2:26014272-26014294 TCAAGTAATTCTCCTGCCTCAGG - Intergenic
929049261 2:37821247-37821269 TGTAGTGATTCCACTACTTCAGG - Intergenic
929107760 2:38380747-38380769 TGTAGTACCTCCAGTGCTTCAGG - Intergenic
929677840 2:43955367-43955389 TCAAGTAATCCTCCTGCTTCAGG - Intronic
930125030 2:47789023-47789045 TCAAGTGATTCTCCTGCTTCAGG + Intronic
936579761 2:113688184-113688206 TCAAGTAATTCTCCTGCCTCAGG - Intergenic
936789500 2:116134327-116134349 TGTAGCATTGCCTCTGCTTCTGG - Intergenic
937096251 2:119237103-119237125 TTTACAAATTCCCCAGCTTCAGG - Intronic
938014286 2:127854806-127854828 TGTAGTAAATCCCCTGTTATAGG - Intronic
938882615 2:135606654-135606676 TCGAGTGATTCCCCTGCCTCAGG - Intronic
939123273 2:138143703-138143725 TTTATTAATTACCCTGTTTCAGG + Intergenic
942673361 2:178401074-178401096 TGGATTAATTTCCATGCTTCTGG + Intergenic
943045051 2:182850709-182850731 TGTATTAATTCCCTTTCTTTTGG + Intronic
943873329 2:193030185-193030207 TGTATTAATTTCCCTTCTTTGGG - Intergenic
944012092 2:194984415-194984437 TGTAGTAATGCTGCTGCTTCTGG - Intergenic
947820622 2:233066704-233066726 TGAAGTGATTCTCCTGCCTCAGG + Intronic
947935564 2:234000776-234000798 TCAAGCAATTCCCCTGCCTCAGG + Intronic
947980563 2:234405149-234405171 TGTAGGGATTCCCCTATTTCCGG - Intergenic
1169726885 20:8744506-8744528 TCAAGCAATTCCCCTGCCTCAGG - Intronic
1172192900 20:33072727-33072749 TGTTGGAATTCCCCTGCCTAAGG + Exonic
1172313290 20:33934229-33934251 TCAAGCAATTCTCCTGCTTCAGG - Intergenic
1173182382 20:40814961-40814983 TGCAGTAAAACCCCTACTTCTGG + Intergenic
1173591014 20:44224918-44224940 TGAAGTAATTTCCATCCTTCTGG - Intergenic
1176226895 20:64005673-64005695 TGTAGTGATCCTCCTGCTTCTGG + Intronic
1176798410 21:13394802-13394824 TCTAGTAATCCTCCTGCTTCCGG + Intergenic
1177337808 21:19755683-19755705 TCAAGCAATTCTCCTGCTTCAGG - Intergenic
1178907492 21:36648722-36648744 TCCAGCAATTCTCCTGCTTCAGG - Intergenic
1178930592 21:36815124-36815146 TCAAGCAATTCTCCTGCTTCAGG + Intronic
1179359783 21:40695015-40695037 TGAAATCATTCCCCTGCTTAGGG - Intronic
1180666047 22:17513114-17513136 TCAAGTAAATCTCCTGCTTCAGG - Intronic
1181092033 22:20480378-20480400 TTTGGTCATTCCCCTGCTACTGG - Intronic
1181263913 22:21619031-21619053 GGTAGTAATTCTCCTGTTACAGG + Intronic
1181272809 22:21669732-21669754 TCTAGTGATTCGCCTGCCTCGGG + Intronic
1181302880 22:21893881-21893903 TCGAGTGATTCGCCTGCTTCAGG - Intergenic
1181570602 22:23766131-23766153 GGTAGTACTTGCACTGCTTCAGG + Exonic
1182840047 22:33381982-33382004 TGTACCAGCTCCCCTGCTTCTGG - Exonic
1183152229 22:36046928-36046950 TCAAGTGATTCTCCTGCTTCGGG - Intergenic
949519982 3:4842465-4842487 TTAAGTGATTCTCCTGCTTCAGG + Intronic
949547291 3:5082974-5082996 TGTACTACTTCCACTGCTCCTGG + Intergenic
951429963 3:22595198-22595220 TGAAGTAATCCACCTACTTCTGG - Intergenic
952187299 3:30983741-30983763 TCAAGGAATTCTCCTGCTTCAGG - Intergenic
952502613 3:33978124-33978146 TCAAGTGATTCCCCTGCCTCAGG + Intergenic
952784126 3:37135357-37135379 TGAAGCGATTCCCCTGCCTCAGG - Intronic
953435346 3:42873247-42873269 TCAAGTAATTCTCCTGCCTCAGG - Exonic
953689589 3:45106717-45106739 GGTAGTTGTTCCCCTGCTTCTGG + Intronic
954815059 3:53273733-53273755 TTTATTAATTCCCCAGCCTCAGG - Intergenic
961022787 3:123523193-123523215 TGTCCTAATGCCCCTGCTTCCGG - Intronic
961185019 3:124907239-124907261 TCAAGCAATTCTCCTGCTTCAGG + Intronic
962358046 3:134711860-134711882 TCAAGTGATTCTCCTGCTTCAGG + Intronic
963114595 3:141715635-141715657 TCAAGTAATTCTCCTGCCTCAGG + Intergenic
964906032 3:161721615-161721637 TCAAGCAATTCTCCTGCTTCAGG - Intergenic
965416559 3:168401969-168401991 TGTCGTGATCCACCTGCTTCGGG + Intergenic
965555875 3:170017957-170017979 TCAAGTAATTCTCCTGCCTCAGG + Intergenic
966186475 3:177231529-177231551 TGTTGTAATTTTCCTGCTTTAGG + Intergenic
966667115 3:182483784-182483806 TGTACTAATTACCATGCTACAGG - Intergenic
967362614 3:188648707-188648729 TGGAGAAATTCCCCAGCCTCAGG - Intronic
967765319 3:193272583-193272605 TGTAGTAATTCCCCTGCTTCGGG - Intronic
967810201 3:193753329-193753351 TGTTGTCTTTCCCCAGCTTCTGG + Intergenic
968830695 4:2931767-2931789 TGAAATAACGCCCCTGCTTCAGG - Intronic
972582680 4:40408810-40408832 TCAAGTGATTCTCCTGCTTCAGG + Intergenic
972874268 4:43339083-43339105 TGTACACATTCCCCAGCTTCTGG - Intergenic
974382541 4:61160100-61160122 TCAAGTGATTCCCCTGCCTCAGG + Intergenic
974996373 4:69164756-69164778 TTTATTAATTACCCAGCTTCAGG + Intronic
975009355 4:69329686-69329708 TTTATTAATTACCCAGCTTCAGG + Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
976780999 4:88758960-88758982 TGCAGCAATTCCACTCCTTCAGG + Intronic
978172414 4:105689130-105689152 TGGAGTTTTTCCCCAGCTTCAGG - Intronic
980347540 4:131641345-131641367 TGTAGTAATTTCACAGCTTAAGG - Intergenic
981958910 4:150512019-150512041 TTTAGTAATTCCAGTGCTACTGG + Intronic
981961041 4:150539073-150539095 TCAAGCAATTCTCCTGCTTCAGG + Intronic
983362189 4:166740623-166740645 TCAAGCAATTCTCCTGCTTCAGG + Intronic
983555702 4:169057552-169057574 TCAAGTGATTCCCCTGCCTCCGG - Intergenic
985390657 4:189489081-189489103 TGAAGTCATTTCACTGCTTCTGG + Intergenic
988181867 5:27806033-27806055 TGTAGAAGTTCCCCTGAGTCTGG - Intergenic
990254154 5:53947531-53947553 TGTATTAAATGCCCTGCATCAGG - Intronic
990441553 5:55850993-55851015 TGAAGTGATTCTCCTGCCTCAGG - Intergenic
990487956 5:56277798-56277820 TGAAGCACTTCCCCAGCTTCAGG - Intergenic
990606278 5:57413628-57413650 TCCAGTGATTCCCCTGCCTCAGG + Intergenic
991232127 5:64346467-64346489 TCAAGTAATTCTCCTGCCTCAGG + Intronic
992208353 5:74452828-74452850 TGTATAAATTACCCAGCTTCAGG - Intergenic
993493493 5:88581003-88581025 CGTTGCAATTCTCCTGCTTCAGG - Intergenic
993762209 5:91809509-91809531 TCAAGCAATTCCCCTGCCTCAGG - Intergenic
995453480 5:112328207-112328229 TCAAGTGATTCTCCTGCTTCAGG - Intronic
995709180 5:115017411-115017433 TCAAGTGATTCTCCTGCTTCAGG - Intergenic
995878174 5:116814021-116814043 TGAAGTAATTTCCCTGTTACTGG + Intergenic
998810844 5:145964404-145964426 TCAAGTGATTCTCCTGCTTCAGG + Intronic
1002647445 5:180667288-180667310 TCAAGTGATTCCCCTGCCTCAGG + Intergenic
1004659657 6:17698767-17698789 TCAAGTGATTCTCCTGCTTCAGG - Intronic
1005120021 6:22379391-22379413 AGTAGAAATTCCCCTGACTCTGG + Intergenic
1005615340 6:27567170-27567192 TCAAGCAATTCCCCTGCCTCGGG - Intergenic
1010545863 6:77155013-77155035 TGTAGTAATTTCACTGTTTGAGG + Intergenic
1011080271 6:83483030-83483052 TCAAGTAATTCACCTGCCTCAGG - Intergenic
1011466928 6:87667827-87667849 TCGAGCAATTCCCCTGCCTCAGG - Intergenic
1012130512 6:95485473-95485495 TCAAGTGATTCTCCTGCTTCAGG - Intergenic
1012865893 6:104617315-104617337 TGTATAAATTACCCTGTTTCAGG + Intergenic
1013274296 6:108569631-108569653 TCTAGTAATTCCGCTACTCCTGG + Intronic
1015252439 6:131141459-131141481 TTTAGTAATTACCCAGCCTCAGG + Intronic
1015303742 6:131683107-131683129 TGTGCAAATTCCGCTGCTTCAGG - Exonic
1015682628 6:135824976-135824998 TCAAGTGATTCCCCTGCATCAGG - Intergenic
1017576668 6:155812998-155813020 AGGAGTAATTCACCTCCTTCAGG - Intergenic
1017914650 6:158821772-158821794 TCAAGTGATTCTCCTGCTTCAGG - Intergenic
1018196088 6:161357149-161357171 TCAAGTAATTCTCCTGCCTCAGG + Intronic
1019680064 7:2342553-2342575 TTAAGCAATTCTCCTGCTTCAGG - Intronic
1021252452 7:18347695-18347717 TTAAGTGATTCTCCTGCTTCAGG + Intronic
1021694033 7:23259034-23259056 GGAAGTAATTCCTCTCCTTCAGG - Intronic
1022384336 7:29887678-29887700 TCTAGTGATTCCCCTGCTTTGGG + Intronic
1022425581 7:30265834-30265856 TCAAGTGATTCCCCTGCCTCAGG + Intergenic
1023163421 7:37320175-37320197 TCAAGTAATTCTCCTGCCTCAGG - Intronic
1023359083 7:39397590-39397612 TCAAGTAATTCTCCTGCCTCAGG + Intronic
1023607288 7:41942239-41942261 TCAAGTGATTCGCCTGCTTCAGG - Intergenic
1023774950 7:43596766-43596788 TCCAGCAATTCCCCTGCCTCAGG - Intronic
1023820058 7:43975622-43975644 TCAAGCAATTCCCCTGCCTCAGG + Intergenic
1024432379 7:49303804-49303826 TGAAGTGATTCTCCTGCCTCAGG + Intergenic
1025778425 7:64578198-64578220 TCAAGTAATTCTCCTGCCTCAGG - Intergenic
1026167461 7:67922960-67922982 TCAAGCAATTCTCCTGCTTCAGG + Intergenic
1026788327 7:73315978-73316000 TCAAGTGATTCTCCTGCTTCAGG + Intronic
1029120292 7:98263290-98263312 TGAAGTGATTCTCCTGCCTCAGG + Intronic
1030092530 7:105870180-105870202 TGAAGTGATTCTCCTGCCTCAGG - Intronic
1031329147 7:120442109-120442131 GGTAGTCAGTCCCCTGATTCAGG - Intronic
1032348750 7:131140711-131140733 TTTAGAAATTACCCAGCTTCAGG + Intronic
1032981772 7:137292335-137292357 TGTAGTAATTCCCATGTCACGGG + Intronic
1035961239 8:4140396-4140418 TCAAGCAATTCTCCTGCTTCAGG - Intronic
1036241968 8:7089096-7089118 TGAAGTGATTCTCCTGCCTCAGG + Intergenic
1036509324 8:9386030-9386052 TGTAATGATTCCCCTACTGCTGG - Intergenic
1037080434 8:14778473-14778495 TGCAGTAATTCCCATGCTTTTGG - Intronic
1037216305 8:16456563-16456585 TGAAGTGATTCTCCTGCCTCAGG - Intronic
1038707497 8:29908605-29908627 TCAAGCAATTCTCCTGCTTCGGG + Intergenic
1043121209 8:76326849-76326871 TGTAGTAATACTTCTGCTTCTGG - Intergenic
1045153034 8:99430816-99430838 TCAAGTGATTCCCCTGCCTCAGG + Intronic
1045511908 8:102818187-102818209 TGTACCCATTCCCCTGCTACCGG + Intergenic
1046336782 8:112800900-112800922 TGAAGTAATTTCCCTTCTTATGG - Intronic
1046851684 8:118981597-118981619 TGTAGTAATTCTATTTCTTCAGG + Intergenic
1047304663 8:123643022-123643044 TTTATTAATTCCCCAGCCTCAGG - Intergenic
1047781495 8:128115263-128115285 TGAAGTATTTCCCCTCCTCCTGG - Intergenic
1048196190 8:132333831-132333853 TCAAGTGATTCCCCTGCCTCAGG + Intronic
1048243612 8:132768789-132768811 TGAAATAATTCCCCTTCTGCAGG - Intergenic
1051753089 9:20365174-20365196 TCTAGAAATTCCCCTTTTTCCGG - Intronic
1051782774 9:20708507-20708529 TGTAGTAATCCCAGTGCTTTGGG + Intronic
1057347044 9:94260150-94260172 TGGCGTGATTCCCCTGCCTCAGG + Intronic
1058434131 9:104946649-104946671 TCAAGCAATTCCCCTGCCTCAGG + Intergenic
1062732194 9:138116352-138116374 TCTTGTAAGTCACCTGCTTCTGG - Intronic
1187289577 X:17940228-17940250 TGTAGAAATTACCCAGCCTCGGG + Intergenic
1187615611 X:20990734-20990756 TTTATAAATTACCCTGCTTCGGG - Intergenic
1190228149 X:48561289-48561311 TGAAGTATTTCCCCTCCATCAGG - Exonic
1190628960 X:52366591-52366613 TCAAGTGATTCTCCTGCTTCAGG - Intergenic
1191987468 X:66997748-66997770 TCTATAAATTCCCCAGCTTCAGG + Intergenic
1193192223 X:78584180-78584202 TTTATAAATTGCCCTGCTTCAGG + Intergenic
1194416554 X:93619221-93619243 TGTATTAATTCTCCTGATTTTGG - Intergenic
1195255840 X:103089870-103089892 TGTGGTAATTTCACTTCTTCAGG + Intronic
1195539902 X:106051614-106051636 TCTAGTAATTTCATTGCTTCAGG - Intergenic
1195628245 X:107026428-107026450 TCAAGCAATTCTCCTGCTTCAGG - Intergenic
1197407312 X:126068052-126068074 TGTAGTAATTTCACAGTTTCAGG - Intergenic
1198470602 X:136942963-136942985 TCAAGTAATTCTCCTGCCTCAGG + Intergenic
1198502793 X:137268992-137269014 TGTATTCATGCCCCTGATTCAGG + Intergenic
1199585066 X:149406022-149406044 TGTTGTAATTCCCTTGGTGCAGG + Intergenic
1199854318 X:151747772-151747794 TGCAGTCATCCCCCTGTTTCTGG - Intergenic
1201795134 Y:17888603-17888625 TGTAGAAATTCACCTCCTTTTGG - Intergenic
1201806421 Y:18017378-18017400 TGTAGAAATTCACCTCCTTTTGG + Intergenic
1202060629 Y:20884247-20884269 TCAAGTAATTCTCCTGCCTCAGG - Intergenic
1202356574 Y:24057685-24057707 TGTAGAAATTCACCTCCTTTTGG - Intergenic
1202514204 Y:25612424-25612446 TGTAGAAATTCACCTCCTTTTGG + Intergenic