ID: 967765819

View in Genome Browser
Species Human (GRCh38)
Location 3:193278288-193278310
Sequence CAGACTAATTAGATGACGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967765819 Original CRISPR CAGACTAATTAGATGACGGC AGG (reversed) Intronic
907327599 1:53650740-53650762 CAGACTAAAGAGATGGCGGAAGG + Intronic
911998636 1:104800390-104800412 CTGACTGATTAGATGATGCCTGG + Intergenic
915515871 1:156412441-156412463 CAGACTACTTAGAGGACTGTGGG - Intronic
1063869785 10:10405043-10405065 CACACTAATGAGATGACTGGTGG + Intergenic
1072326868 10:94307482-94307504 CAGACTAATTAAATGACCACGGG - Intronic
1078700580 11:13677860-13677882 TAGACTAATTAGAAAACTGCAGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079982587 11:27166899-27166921 CAGACTATTCACATGATGGCTGG + Intergenic
1080581303 11:33646058-33646080 CAGACTGACCAGATGATGGCAGG - Intronic
1082648974 11:55763285-55763307 CAGACTAACAAGATGATAGCTGG - Intergenic
1085706998 11:78795258-78795280 GAGATTAATTTGATGATGGCAGG - Intronic
1088032726 11:105271008-105271030 CAGAAAAATTAGATGACGTTGGG - Intergenic
1097149418 12:56965437-56965459 CAGAGTAATTAGAGGTTGGCAGG - Intergenic
1107625437 13:42277327-42277349 TAGAATAATCAGATGAAGGCAGG - Intronic
1109447755 13:62466376-62466398 CAGACTAATTTGAGTTCGGCAGG + Intergenic
1112195599 13:97223254-97223276 CAGAATAATTTAATGAGGGCAGG + Intronic
1117116732 14:52521452-52521474 CGGACTAAATAGAAGACAGCTGG + Intronic
1124285013 15:28393724-28393746 AAGACTAATAGCATGACGGCAGG - Intergenic
1124297684 15:28517890-28517912 AAGACTAATAGCATGACGGCAGG + Intergenic
1129148409 15:73670755-73670777 CAGATTCAATAGATGAAGGCTGG - Intergenic
1135877506 16:26216837-26216859 CAGATTAAATAGCTGAGGGCTGG + Intergenic
1155851074 18:30774693-30774715 CAGACTAATCCACTGACGGCTGG - Intergenic
1156995067 18:43455625-43455647 AAGACTAAATAGAGGAAGGCTGG + Intergenic
1160024166 18:75204968-75204990 CAGACAATTTAGAAGACGGCGGG - Intronic
931629764 2:64288330-64288352 CACACTAATGAGATCAAGGCTGG - Intergenic
935869949 2:107436919-107436941 CAGAATAATTAGAAGACAGTGGG - Intergenic
938926391 2:136046945-136046967 CAGACTAATTTGGTGAAGGAGGG + Intergenic
939463983 2:142533365-142533387 CAGAGTAATTATATGACAGTGGG - Intergenic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
945565794 2:211397874-211397896 CAGACTAAATAGATGCCCTCTGG - Intronic
948174156 2:235929989-235930011 CAGACTAATTCGCTGGCAGCAGG + Intronic
1182007370 22:26972044-26972066 CAGGCTAATGAGGTGACTGCAGG + Intergenic
1185214728 22:49591976-49591998 CAGGAAAATTAGATGACGGGAGG - Intronic
950032113 3:9860154-9860176 CAGGCAAATAAGATGAGGGCAGG - Intergenic
953809815 3:46102482-46102504 CAGACTTCTTACATGACAGCTGG + Intergenic
955144175 3:56299724-56299746 AAGAATATTTAAATGACGGCCGG - Intronic
958782627 3:98561229-98561251 CAGACTAATTCAATGAGGGAAGG + Intronic
965794535 3:172426212-172426234 CAGACTATTTCGATGACAACTGG + Intergenic
967605686 3:191442921-191442943 CAGGACAATTAGATGATGGCTGG + Intergenic
967765819 3:193278288-193278310 CAGACTAATTAGATGACGGCAGG - Intronic
980970990 4:139567106-139567128 CAAATGAATTAGATGACAGCAGG - Intronic
982057737 4:151569784-151569806 CAGACTGCTTGGATGATGGCTGG - Intronic
982798363 4:159672503-159672525 TATGCTAATTAGATGACTGCTGG + Intergenic
998987772 5:147781174-147781196 CAGACTAATTTGGAAACGGCTGG + Intronic
1018459050 6:163980178-163980200 CAGAATAATTACATGACCCCGGG - Intergenic
1022652233 7:32287814-32287836 AATACTAATTAGATGACGTGAGG + Intronic
1037058145 8:14470643-14470665 AAGACTAACTATATGACGGTTGG + Intronic
1045295823 8:100870999-100871021 CAGACTCAGTAGATGATGGAGGG + Intergenic
1046604353 8:116354360-116354382 CAGAGTAATTAGATTACTGATGG - Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1056114770 9:83431209-83431231 GAGACTAGTTAGATGAGGGAAGG - Intronic
1058837618 9:108872966-108872988 CTGACAAATTATATGACAGCAGG + Intronic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1060317366 9:122525044-122525066 TAGACTAAGGAGATGAGGGCAGG + Intergenic
1186539705 X:10388288-10388310 TAGGCTAATTAGATGACTGATGG + Intergenic
1189757882 X:44290127-44290149 CAGAGCAATGAGATGATGGCAGG - Intronic