ID: 967766866

View in Genome Browser
Species Human (GRCh38)
Location 3:193290604-193290626
Sequence CTGGATACACAGGTGAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967766860_967766866 19 Left 967766860 3:193290562-193290584 CCAGGCACTGTGATAGATGCTAG 0: 1
1: 6
2: 42
3: 362
4: 1418
Right 967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG 0: 1
1: 0
2: 1
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967766866 Original CRISPR CTGGATACACAGGTGAATGG GGG Intronic
900869239 1:5289973-5289995 ATGGATACATGGATGAATGGTGG + Intergenic
905259854 1:36709569-36709591 CTGGATACTGAGGTGAACCGTGG + Intergenic
907156748 1:52342120-52342142 CTGGATGCACTGGAGAGTGGTGG - Intronic
907529060 1:55074894-55074916 GTGGAAATACAGGTAAATGGTGG + Intronic
910071094 1:83214127-83214149 CTGGAGCCACAGGTGAGTGGAGG - Intergenic
910564302 1:88626008-88626030 CTAGATACACGGGGAAATGGAGG - Intergenic
910772753 1:90846464-90846486 CTGGATCCACATGTGAATTTTGG + Intergenic
911118623 1:94272447-94272469 CTGGATAACCAGGTGCAAGGAGG + Intronic
911559508 1:99387107-99387129 GTGTAAACACAGTTGAATGGAGG - Intergenic
913237356 1:116796493-116796515 CTGGAGACACAGGGACATGGAGG - Intergenic
913435324 1:118841656-118841678 CTGGGGACAGGGGTGAATGGGGG - Intergenic
913993351 1:143635173-143635195 GTGGAAACACAGAGGAATGGAGG + Intergenic
916005418 1:160654991-160655013 CTGGAGAGAGAGGTGAATTGTGG + Intergenic
916922059 1:169479038-169479060 CAGGTTATACAGGTGAATGTAGG - Intronic
917209472 1:172616686-172616708 CTGGATGGACAGGTGAACAGTGG + Intergenic
918465573 1:184818454-184818476 ATGAATAGACAGATGAATGGTGG + Intronic
919806181 1:201382241-201382263 CTGGACGCTGAGGTGAATGGTGG - Exonic
920981203 1:210837268-210837290 CTGGGAACACAGGGGAAGGGTGG - Intronic
923885771 1:238153599-238153621 CTGCATACACAGTAGAAAGGTGG + Intergenic
1065791026 10:29261318-29261340 CTGGATACAATGGTGAAAAGCGG - Intergenic
1067452200 10:46388680-46388702 CTGGATCCCAAGGGGAATGGGGG + Intronic
1067585037 10:47471075-47471097 CTGGATCCCAAGGGGAATGGGGG - Intronic
1067704938 10:48599624-48599646 ATGGATACAAAGGTGTGTGGTGG - Intronic
1069167072 10:65174712-65174734 CTGGAAAGACAGGTGACTGCTGG - Intergenic
1074654581 10:115570588-115570610 CTGGATACTGAGGTCACTGGGGG - Intronic
1076039840 10:127236795-127236817 CTGGCTACATAAATGAATGGTGG - Intronic
1076594160 10:131615311-131615333 ATGGATGCACAGGTGTATGGAGG + Intergenic
1076594164 10:131615343-131615365 ATGGATGCACTGGTGTATGGAGG + Intergenic
1076594168 10:131615375-131615397 ATGGATGCACTGGTGTATGGAGG + Intergenic
1076867756 10:133176344-133176366 ATGGAAACAAAGGGGAATGGAGG + Intronic
1079032796 11:16998001-16998023 TTGGATGCACAGGTGTAAGGCGG - Intronic
1080631068 11:34076583-34076605 CAGGTCCCACAGGTGAATGGAGG - Exonic
1080729169 11:34930765-34930787 CTGGATCCCCAGTTGAATTGTGG + Intronic
1080856483 11:36116159-36116181 CTGGTTATATAGGGGAATGGTGG - Intronic
1084089408 11:66870291-66870313 CTCGCTAAACAGGTGAAGGGTGG - Exonic
1084942808 11:72622687-72622709 CTGGAGACAGAGGAGGATGGGGG + Intronic
1085072221 11:73557296-73557318 ATGGAGACAAAGTTGAATGGTGG + Intronic
1085189377 11:74605321-74605343 CTGGCAACACAGGTGACTGCTGG + Intronic
1087360911 11:97158429-97158451 AAGGAAACACATGTGAATGGGGG - Intergenic
1089361955 11:117896780-117896802 CTGGCTCCACAGGTGTATGTTGG + Intergenic
1089565931 11:119371786-119371808 GTGGATACACGGGTAGATGGCGG - Intronic
1090653428 11:128825266-128825288 CTGGAGCCACTGGTGGATGGCGG + Intergenic
1092069265 12:5619519-5619541 CTGGATACACAGCTAGATGGGGG + Intronic
1092213329 12:6662773-6662795 CTGGAGACCCTGGAGAATGGGGG + Intronic
1092532955 12:9360397-9360419 CTGGATGCCCAGGGGACTGGAGG + Intergenic
1093369246 12:18346825-18346847 CTGGGTGCACAGGTGAGTGGTGG + Exonic
1096528651 12:52229818-52229840 CTGGAAAGAAAGGTGAAAGGAGG + Intergenic
1101663144 12:106784830-106784852 ATGGGGATACAGGTGAATGGAGG - Intronic
1108405305 13:50095060-50095082 CTAGTTACAAAGATGAATGGTGG - Intronic
1109219803 13:59629566-59629588 CTGGAAAAACTGGTGAATGGTGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113034909 13:106038044-106038066 CTTGATACTTAGGTGAAGGGTGG + Intergenic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1115922464 14:38391552-38391574 CAAGATACAAAGGTGAATGTTGG + Intergenic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1119193983 14:72703261-72703283 ATGGAGACACAGGGGATTGGGGG + Intronic
1121755579 14:96399561-96399583 TTGGATAGACCAGTGAATGGCGG - Intronic
1122958403 14:105083401-105083423 GTGGATAGACGGGTGGATGGAGG - Intergenic
1125732242 15:41899617-41899639 CTGTGGACACAGGTGAATGAGGG - Exonic
1125834139 15:42735974-42735996 CTGGGGACACAGCTGATTGGGGG + Exonic
1126884007 15:53130273-53130295 CTGGATACATAGGGGGATGCAGG + Intergenic
1127244334 15:57155272-57155294 CTGGATACACAAGTAAATTCAGG - Intronic
1129270782 15:74418257-74418279 CTGGATAAGCGGGTGAGTGGGGG - Exonic
1130419123 15:83724723-83724745 GGGGATACACAGTAGAATGGTGG - Intronic
1130906220 15:88242557-88242579 TTGGAGCTACAGGTGAATGGAGG - Intronic
1131660750 15:94512730-94512752 GTGCATACACATGTGAATGTAGG - Intergenic
1131966363 15:97848171-97848193 CTGGATTCTCAGATAAATGGAGG + Intergenic
1133165932 16:3947193-3947215 ATGAACAGACAGGTGAATGGAGG + Intergenic
1136987484 16:35123644-35123666 CTCAAGACTCAGGTGAATGGTGG - Intergenic
1137672575 16:50287944-50287966 CTGGATGCACAGGAGGATGCTGG + Exonic
1141055491 16:80810037-80810059 CTGAGTATTCAGGTGAATGGAGG + Intergenic
1141314301 16:82946204-82946226 ATGGATACATGGATGAATGGAGG + Intronic
1142034456 16:87854890-87854912 GTGGAGACACAGGTGAAGGGAGG - Intronic
1142121362 16:88388128-88388150 GTGGATAGGCAGGTGAGTGGAGG + Intergenic
1142121823 16:88390276-88390298 CTGGATACACATGGGAGTAGGGG + Intergenic
1142392532 16:89811606-89811628 CTGGTTGCTCAGGAGAATGGTGG - Intronic
1143252622 17:5534454-5534476 CTGGATGCATGGGTGGATGGAGG - Intronic
1143950952 17:10631802-10631824 CTGCATACCCAGGTGAGGGGAGG - Exonic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1149439630 17:56663670-56663692 CTGGATGCCCAGGAGAATGACGG + Intergenic
1152837097 17:82540479-82540501 ATGGCTACACAGGGGAAAGGGGG - Intronic
1153084962 18:1274762-1274784 CTGGAGACACAAGAGAAAGGGGG + Intergenic
1154024635 18:10696018-10696040 CAGGAAACACAGTTGCATGGAGG + Intronic
1154128382 18:11714434-11714456 CTGAATCCACATGTGAAAGGAGG + Intronic
1155678961 18:28466202-28466224 CTGTTTACACTGGTGAATGAGGG - Intergenic
1157958856 18:52129872-52129894 CTGGATACAGATTTGTATGGAGG + Intergenic
1159865800 18:73703199-73703221 CTGGAAAGACAGGTGCATTGAGG - Intergenic
1160322052 18:77905501-77905523 CTGGATGGACAGGTGGAAGGTGG + Intergenic
1163488152 19:17601718-17601740 CTGGAGACACAGGTCACAGGCGG - Exonic
1163787342 19:19281668-19281690 CTCAACACACAGGTGCATGGAGG - Intronic
1168360118 19:55732484-55732506 TTGGATACACAGATGCATGAAGG + Exonic
1168643826 19:58047208-58047230 CAAGGTCCACAGGTGAATGGAGG - Intronic
925271213 2:2608819-2608841 CTGGGGACCCAGGAGAATGGCGG + Intergenic
925524609 2:4786218-4786240 CCACATACACAGGTGAAAGGTGG - Intergenic
925917159 2:8614959-8614981 CTGGATGACCAGGTGAATGGTGG + Intergenic
927699946 2:25261672-25261694 CTGCATAGATAGGTGAAAGGGGG + Intronic
928795028 2:35007773-35007795 CAGGATAAACAGGTGAAAGGAGG + Intergenic
929229575 2:39545501-39545523 CTGGATTCAAAGTTGATTGGAGG + Intergenic
929297683 2:40266961-40266983 CTGGATGTACAGGTAAATGAGGG + Intronic
933498037 2:83076153-83076175 TTGGAGACACAGCTGAATAGGGG + Intergenic
933937885 2:87221166-87221188 CTGGATATGCAAGTGAGTGGTGG + Intergenic
934928261 2:98397163-98397185 CTGGAAAGCCAGGTGAAGGGTGG + Exonic
935037631 2:99394413-99394435 CTCGCTCCACAAGTGAATGGTGG + Intronic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
936355252 2:111744606-111744628 CTGGATATGCAAGTGAGTGGTGG - Intergenic
936887808 2:117334035-117334057 ATGGATACACTGCTGGATGGAGG + Intergenic
937826239 2:126371423-126371445 CTGGCTGCACAGGTGTGTGGGGG - Intergenic
938185303 2:129226440-129226462 CTAGACAGACAGGTGAAAGGGGG + Intergenic
938187173 2:129242052-129242074 CTGAATACACACGTGACTAGTGG + Intergenic
946025792 2:216670962-216670984 CTGGCTACCCAGGTGACTGCAGG + Intergenic
946141229 2:217692377-217692399 CTGGAGAAAGAGGGGAATGGAGG - Intronic
948068424 2:235100336-235100358 GTGGATACACAGGTGCATAAAGG - Intergenic
948267330 2:236644666-236644688 CTGGAGACCAAGCTGAATGGTGG - Intergenic
1169421999 20:5467924-5467946 CTGGTTACACAAGTGAGTTGAGG - Intergenic
1170006206 20:11672088-11672110 CTAGATACAAAGAAGAATGGTGG - Intergenic
1170477669 20:16732054-16732076 CTGTATAAATAAGTGAATGGTGG + Intronic
1170776536 20:19379595-19379617 CTGGTTACAAAGGTAACTGGGGG - Intronic
1171063928 20:21994712-21994734 GTGGATAGAAAGCTGAATGGAGG + Intergenic
1172651028 20:36501544-36501566 CTAGATTCACAGGTGGTTGGAGG + Intronic
1172853272 20:37981973-37981995 CAGGAAACACAGGTGAGAGGAGG + Intergenic
1174502706 20:50997256-50997278 CTGGATACCCTGGTGCTTGGAGG - Intergenic
1175660356 20:60807428-60807450 TTGGATACACAAATAAATGGGGG - Intergenic
1175765358 20:61588662-61588684 CTGGAGACAGAGGAGAAAGGGGG - Intronic
1178973218 21:37199511-37199533 CTGGACGCAGAGATGAATGGAGG - Intronic
1181002413 22:19994094-19994116 ATGGATACAGGGGTGGATGGGGG + Intronic
1181364812 22:22367730-22367752 CTGGAGACAGAAGTGGATGGAGG + Intergenic
1184496523 22:44845570-44845592 CTGGACAGACAAGGGAATGGAGG - Intronic
1185418561 22:50722571-50722593 CCGGATTCAGAGGTGGATGGCGG - Intergenic
950503532 3:13378901-13378923 CTGGATACCTAGGTGAGTGTGGG - Exonic
951623943 3:24639445-24639467 CTGGAGAGACAGGTGAATCTAGG - Intergenic
952821675 3:37491522-37491544 CTGGGAACACAGGAGACTGGAGG + Intronic
953976244 3:47383751-47383773 CTGGAGGCCCAGGTGCATGGAGG - Intronic
955919448 3:63940105-63940127 CTGGATTCCCAGGAGTATGGTGG - Intronic
957368626 3:79259976-79259998 CTTGATAAACTGGTGAAGGGAGG - Intronic
960425280 3:117499411-117499433 CTGAGTACACAGCTGAATGTGGG + Intergenic
961205171 3:125076015-125076037 CTTGATACACTGGAGAATTGGGG - Intergenic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
964907229 3:161732343-161732365 CAGAATACACAGGTGACTTGTGG - Intergenic
966251875 3:177875161-177875183 ATGGATACACAGGTTCATGTTGG + Intergenic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
967921445 3:194617228-194617250 CCGGGTCCACAGGTGGATGGAGG + Exonic
968736747 4:2301235-2301257 CTTGAGACACAGATGAGTGGGGG + Intronic
969582365 4:8072709-8072731 CTGGACGCCCAGGTGAGTGGTGG + Intronic
969994860 4:11301596-11301618 CTTCATACACAGGTGTGTGGTGG - Intergenic
970715244 4:18913822-18913844 CTGGATACATAGGTGTGTGTAGG - Intergenic
971507642 4:27383802-27383824 ATGGAAACACAGTGGAATGGTGG + Intergenic
972369856 4:38412652-38412674 CTGTTTACTCAGGTGGATGGAGG + Intergenic
972413727 4:38818600-38818622 CAGCATTCTCAGGTGAATGGGGG - Intronic
973553380 4:52057509-52057531 CTGGGTACCCAGAGGAATGGTGG - Intronic
977017858 4:91715937-91715959 CTTCAAAGACAGGTGAATGGTGG + Intergenic
977115249 4:93016300-93016322 CTGGGTTCAGAGGTGAATAGAGG - Intronic
977238296 4:94535494-94535516 CTGGATAATGGGGTGAATGGTGG - Intronic
977709329 4:100106791-100106813 GAGGATACACAGGAGACTGGTGG + Intergenic
980693097 4:136320953-136320975 GTGGATACACAGGTGCTTGAAGG + Intergenic
980999130 4:139811283-139811305 CTGGAAACACAGGATGATGGAGG - Intronic
985536732 5:469309-469331 CTGTATACACAGGCGAGAGGAGG - Intronic
987526369 5:19055492-19055514 CTGTATACATATGTGAATGTGGG - Intergenic
991224537 5:64254836-64254858 CTGGATTCACAGGTTTATGAGGG + Intronic
994261394 5:97662987-97663009 CTGGAAACAAAGATGAATGCTGG + Intergenic
995796237 5:115944624-115944646 GTGGAAACACTTGTGAATGGGGG - Intergenic
997339067 5:133128371-133128393 CTGGATGGATAGGTGGATGGTGG + Intergenic
997374558 5:133387888-133387910 CTGGATACACCAGTGAAGGCAGG + Intronic
997447732 5:133953706-133953728 CTGGGTACACAGATGAATGCGGG - Intergenic
997607089 5:135182848-135182870 CTGGATGCTAAGGTGACTGGTGG - Intronic
997656405 5:135558005-135558027 CTGGTTACACATGTGAATAAGGG + Intergenic
997755567 5:136395717-136395739 CTGAATTCATAGGTGAGTGGTGG + Intronic
997826562 5:137111913-137111935 AGGGATTCACAGATGAATGGGGG - Intronic
998629744 5:143884820-143884842 GTGAATATACAGGTGAATGTAGG - Intergenic
1002027532 5:176405682-176405704 CTGGGTACACAGGGGCGTGGAGG + Intronic
1002058583 5:176612726-176612748 CTGGATGCTCAGGTGGAAGGTGG + Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1006044233 6:31280848-31280870 ATGGAGATCCAGGTGAATGGAGG + Intronic
1006218288 6:32465243-32465265 CTTGATAAATAGGTGGATGGTGG - Intergenic
1008017058 6:46532346-46532368 CTTGAAACCCTGGTGAATGGAGG + Intergenic
1008380353 6:50834147-50834169 CTTAATAGACAGGTGATTGGTGG - Intronic
1008698130 6:54065679-54065701 CTGGAAACACAAGAGAGTGGAGG - Intronic
1010189803 6:73183489-73183511 CTGGACACAGAGCTGGATGGCGG - Intronic
1013220248 6:108071811-108071833 GTGGATAAACAGGTGAAAAGAGG - Intronic
1018199859 6:161384637-161384659 CTGGAGACACAGGGGAACAGAGG + Intronic
1019626270 7:2017477-2017499 CTGGATACACCGGCCGATGGGGG + Intronic
1019720254 7:2565648-2565670 CTGGACACACAGGTTAGCGGGGG - Intronic
1022563670 7:31375219-31375241 GTGGGTACAGAGGTAAATGGGGG - Intergenic
1022594402 7:31698407-31698429 CTGTATACCAAGATGAATGGTGG + Intronic
1024196679 7:47066026-47066048 TTGGTCACACAGTTGAATGGTGG - Intergenic
1025157443 7:56620997-56621019 CGGGATGGACAGGTGAATGGCGG + Intergenic
1025758324 7:64367118-64367140 CGGGATGGACAGGTGAATGGCGG - Intergenic
1027288808 7:76678986-76679008 CTGGAGCCACAGGTGAGTGGAGG - Intergenic
1032072811 7:128819282-128819304 CTGGCTGCACAGGTGCATGTTGG - Intronic
1032785139 7:135194627-135194649 CTGGAAACACAGACAAATGGAGG + Intronic
1033801812 7:144910657-144910679 GTGGATACAGAGGGGAGTGGGGG - Intergenic
1034463998 7:151214963-151214985 CTCGATATCCAGGTGATTGGTGG + Exonic
1035816343 8:2545173-2545195 CTGGAACCAAAGGTGGATGGGGG + Intergenic
1037961545 8:23102108-23102130 CTGGATAGACACTTGACTGGGGG + Intronic
1039235869 8:35502232-35502254 CTGGATAAACAGTCCAATGGTGG + Intronic
1040374452 8:46810437-46810459 CGGGATAGACAGGTGAATGGCGG - Intergenic
1043196304 8:77296478-77296500 TTGGAGACACAGCTGAATGATGG + Intergenic
1043716742 8:83496511-83496533 CTGGATACATAAGGAAATGGAGG + Intergenic
1045074174 8:98544134-98544156 CTGGATATAGAAGTGAAGGGAGG + Intronic
1047204297 8:122791049-122791071 CTGGAGCCACAGGTGCATGGAGG - Intronic
1047257693 8:123228076-123228098 GAGGATGCACAGGTGGATGGTGG - Intronic
1047561525 8:125992069-125992091 CTGTATGAACAGCTGAATGGGGG + Intergenic
1049350653 8:142162773-142162795 ATGGATTGACAGATGAATGGAGG + Intergenic
1049405168 8:142449163-142449185 ACGGACACACAGATGAATGGAGG - Intergenic
1051828105 9:21244083-21244105 CAGGAAACACAGGTGAATAAAGG - Intergenic
1053111634 9:35465605-35465627 ATGGGTACACGGGTGCATGGGGG + Intergenic
1057837090 9:98454218-98454240 CTGGAAAAACAGGGGATTGGGGG + Intronic
1057855124 9:98595757-98595779 CTGGATAGACAGGAGGCTGGAGG + Intronic
1059646572 9:116274004-116274026 AAGGATACACAGTTAAATGGTGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061672504 9:132196958-132196980 CTTGATAAACAGGTAAATGTAGG - Intronic
1061981049 9:134103827-134103849 CTGGATGGATAGATGAATGGTGG - Intergenic
1062670772 9:137707610-137707632 TTGGACACACAGCAGAATGGTGG + Intronic
1187114000 X:16330949-16330971 CTGGATTCACTGATTAATGGTGG - Intergenic
1188795683 X:34461581-34461603 ATAGAAACACAGTTGAATGGTGG - Intergenic
1190818258 X:53948261-53948283 GTGGTTACACCGGGGAATGGCGG + Intronic
1192151402 X:68714977-68714999 CAGGATTCAAAGGGGAATGGGGG + Intronic
1197479573 X:126965993-126966015 CAGGATGGACGGGTGAATGGAGG + Intergenic
1198513418 X:137377899-137377921 CTGGATGGACAAATGAATGGAGG - Intergenic
1200100141 X:153686097-153686119 CTGGAGACAGAAGTGAAGGGTGG - Intronic