ID: 967768245

View in Genome Browser
Species Human (GRCh38)
Location 3:193305890-193305912
Sequence CATGCATGCGTGTGTGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 1, 2: 24, 3: 81, 4: 506}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967768243_967768245 4 Left 967768243 3:193305863-193305885 CCCAGAGGTAGAAAAGTGGTGTG 0: 1
1: 0
2: 1
3: 19
4: 164
Right 967768245 3:193305890-193305912 CATGCATGCGTGTGTGCATGTGG 0: 1
1: 1
2: 24
3: 81
4: 506
967768244_967768245 3 Left 967768244 3:193305864-193305886 CCAGAGGTAGAAAAGTGGTGTGT 0: 1
1: 0
2: 0
3: 16
4: 164
Right 967768245 3:193305890-193305912 CATGCATGCGTGTGTGCATGTGG 0: 1
1: 1
2: 24
3: 81
4: 506
967768240_967768245 30 Left 967768240 3:193305837-193305859 CCACAAAGTCACTAACTAAACAA 0: 1
1: 0
2: 1
3: 28
4: 313
Right 967768245 3:193305890-193305912 CATGCATGCGTGTGTGCATGTGG 0: 1
1: 1
2: 24
3: 81
4: 506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967768245 Original CRISPR CATGCATGCGTGTGTGCATG TGG Intronic