ID: 967769110

View in Genome Browser
Species Human (GRCh38)
Location 3:193314366-193314388
Sequence CAGAATATGGAGAGGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 505}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967769110_967769115 -10 Left 967769110 3:193314366-193314388 CCCATCTCCCTCTCCATATTCTG 0: 1
1: 0
2: 2
3: 36
4: 505
Right 967769115 3:193314379-193314401 CCATATTCTGCATCATATCCTGG 0: 1
1: 0
2: 2
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967769110 Original CRISPR CAGAATATGGAGAGGGAGAT GGG (reversed) Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901393767 1:8965408-8965430 CAGAAGCTGGAAGGGGAGATGGG - Intronic
901639852 1:10687665-10687687 GAGAAAGGGGAGAGGGAGATGGG + Intronic
901727442 1:11253180-11253202 GAGAATATGGGGAGGAAGCTGGG - Intronic
902213183 1:14918202-14918224 CAGAATAGGGAGAACAAGATGGG + Intronic
902728987 1:18356405-18356427 CAGAAGAGTGGGAGGGAGATTGG + Intronic
902987826 1:20166209-20166231 CAGACTTTGCAGAGGGAGAGTGG - Intronic
903405664 1:23093182-23093204 TAGAAAATGGAGAGGTAGAAGGG - Exonic
903915510 1:26761218-26761240 TAGCATTTGGAGAAGGAGATTGG + Intronic
904206685 1:28860035-28860057 ATGAATATGGAGAGGGAGCGAGG + Intronic
905143361 1:35867077-35867099 TAGAATATGGTGAAGGTGATGGG + Intergenic
905824777 1:41019596-41019618 CAGAATATGCAGAGGAACCTGGG - Intronic
905957785 1:42013573-42013595 CAGAATAAGGGGAGGGCCATGGG + Intronic
905988246 1:42308114-42308136 CAGAAAATGGATAGGCAGGTGGG - Intronic
906031036 1:42720279-42720301 GAGAAAATGGAGAGGCAGCTGGG - Intergenic
906333998 1:44912610-44912632 CCGGATATGGAAAGGGACATGGG - Intronic
906704391 1:47884306-47884328 CAGAACTTGGAGAGGGAAAAAGG - Intronic
906837836 1:49103110-49103132 CTGAAAATGCTGAGGGAGATTGG - Intronic
907386613 1:54129596-54129618 CAGCCTATGGGGAGGGAGCTGGG + Intergenic
907654346 1:56327310-56327332 CTGAAGATGGAGATGGGGATGGG + Intergenic
907816508 1:57923048-57923070 TAGAAAATGGAGAGAGAGACTGG + Intronic
908450009 1:64244706-64244728 GAGAATATGGAGAGAGAGGATGG - Intronic
908788445 1:67757686-67757708 AAGGAGATGGAGAGGGAGTTTGG - Intronic
908828577 1:68157054-68157076 CAGAATTGGGAGAAGGACATGGG + Intronic
909108108 1:71438735-71438757 CAGACTATCGAAAGTGAGATGGG + Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
911550689 1:99275893-99275915 CACAGTAGGGAGAGGGAGAGGGG + Intronic
912254063 1:108041238-108041260 AAGAATATGTAAAGGGAGGTGGG - Intergenic
912647279 1:111405442-111405464 AAGAGTGTGGAGAGTGAGATGGG + Intergenic
912864533 1:113245602-113245624 CAGAATGTGGAGAAAGAGAGAGG - Intergenic
912920034 1:113857671-113857693 AAGAAAAAGGAGAGGGAAATTGG - Intronic
913443080 1:118920201-118920223 CAAAATATCAAGAGGAAGATTGG + Intronic
914225230 1:145714515-145714537 TAAAATATGGAGAGGGAGTCAGG - Intergenic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
915137266 1:153741547-153741569 CAGAATCTGGAGATAGAGAAAGG - Intronic
915721826 1:157991610-157991632 AAGATTAGGGAGAGGGAGAGAGG - Intergenic
916141611 1:161704831-161704853 CAGAATACTCAGGGGGAGATGGG - Intergenic
916315555 1:163444285-163444307 CAGAGTATGGATTGAGAGATTGG + Intergenic
916323864 1:163535238-163535260 CAGAAGCTGGAGAGGTAGTTGGG + Intergenic
918049905 1:180964914-180964936 CAGAAGATGCACAGGCAGATGGG - Intergenic
918059561 1:181049460-181049482 CAGAAGATGCACAGGCAGATGGG - Intronic
919628330 1:199934573-199934595 CAGTAAATAGAGACGGAGATGGG + Intergenic
919773413 1:201177420-201177442 CAGCAGATGGAGGGGGAGATAGG + Intergenic
920046504 1:203136238-203136260 GAGAAGAAGGAGAGGCAGATGGG + Intronic
920099132 1:203506029-203506051 CAGGATATGGAACGGGATATTGG - Intronic
920436200 1:205948596-205948618 TGGAATAGGAAGAGGGAGATGGG - Intergenic
922354349 1:224761816-224761838 CAGAATATGGACAGGGAATACGG - Intergenic
922493099 1:226034420-226034442 CAGAATATGGCAAAGGTGATGGG + Intergenic
922699569 1:227750898-227750920 GAGACTGTGTAGAGGGAGATTGG + Intronic
923142698 1:231174593-231174615 CAGAGAAGGGAGAGGGAGAGGGG - Intronic
923932263 1:238714458-238714480 CAGAATATGGAAAGTTTGATAGG - Intergenic
924247927 1:242103080-242103102 GAGAATTTGGAAAAGGAGATTGG + Intronic
924328298 1:242917778-242917800 GAGAATAGGGAGTGGGAGAAGGG - Intergenic
924659104 1:246000393-246000415 CAGAATGTGAAGATGGAGATAGG + Intronic
1062902193 10:1154806-1154828 CAGAAGAGGCAGAGGGAGACTGG - Intergenic
1064630374 10:17305089-17305111 CGTAATATTCAGAGGGAGATAGG + Intergenic
1064705366 10:18067265-18067287 CAGAAGTTGGAGAGACAGATAGG - Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066815951 10:39412906-39412928 CAGAATCTGCAAAGGGATATTGG + Intergenic
1067224387 10:44366009-44366031 CAGAAGATGCAGTGGGATATAGG + Intergenic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1067796374 10:49325065-49325087 CAGAAGATGGTGAGGGAGTAAGG - Exonic
1068278801 10:54839557-54839579 CAGAAAAAGGAGAGAGAGAAGGG + Intronic
1069268633 10:66495003-66495025 CAGAAAATGCAGAGGGGAATGGG + Intronic
1069344487 10:67452012-67452034 AAGAATAGGAAGAGGGAGAAAGG + Intronic
1069900274 10:71702846-71702868 CAGGAAAAGGATAGGGAGATGGG + Intronic
1070723109 10:78770309-78770331 GAGAAGATGGAGGGAGAGATTGG - Intergenic
1071149348 10:82615789-82615811 TAATATTTGGAGAGGGAGATGGG + Intronic
1071547383 10:86538857-86538879 CATAAGATGGGGAGGGAGAGAGG - Intergenic
1072095703 10:92177391-92177413 CAGAATATAGAAGGGGAGGTAGG - Intronic
1072532648 10:96333833-96333855 CAGAAAATGGACAGGGAAAAGGG + Intronic
1074174168 10:110979368-110979390 CAGAATATGGCAAAGGTGATGGG - Intronic
1074233550 10:111561991-111562013 CAGCATATGGAAAGGCAGAGGGG - Intergenic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1075027806 10:118999376-118999398 CACAATGGGGAGAGGGAGAGAGG + Intergenic
1077347060 11:2065914-2065936 CAGAATATGGAGACTGAGTATGG - Intergenic
1077552562 11:3207535-3207557 CAGCATATGCACAGGGAGAGGGG - Intergenic
1077554084 11:3217720-3217742 CAGAAAATGGAGCTGGAGAGAGG - Intergenic
1078007148 11:7540506-7540528 GAGAATATAGAGAGGGAGGTGGG + Intronic
1078366770 11:10713242-10713264 CAGAAGTTGAAGAGGGAGATAGG + Intergenic
1078811280 11:14767767-14767789 CAGAATATTTAGAGGGAAAAAGG - Intronic
1078925747 11:15873308-15873330 CAGAATAGAGAGAGAGAGAATGG + Intergenic
1078941823 11:16014934-16014956 CAGAAGATGCAGAGGGTGAGTGG - Exonic
1079370754 11:19849950-19849972 AAGAGTATGGAGAGGGAAATGGG - Intronic
1079492403 11:21003586-21003608 CAGAGTATAGAGAAGGAGACAGG - Intronic
1080009471 11:27443191-27443213 TAGACAATGGAGTGGGAGATGGG - Intronic
1080097371 11:28425108-28425130 CAGAAGACTGAGAGGCAGATGGG + Intergenic
1080758955 11:35229304-35229326 CAGAATGTGGACATGAAGATTGG + Exonic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1081634068 11:44709109-44709131 CAGACTGTGGAGGGGGAGAAGGG + Intergenic
1081651643 11:44827823-44827845 CAGAGAAAGGAGAGGGACATGGG + Intronic
1084493513 11:69490835-69490857 CAGAGTCTGGAAAGGGAGGTGGG - Intergenic
1085253210 11:75157094-75157116 ATGAAGATGGAGATGGAGATGGG + Intronic
1085542545 11:77286069-77286091 AAGAAGCTAGAGAGGGAGATGGG - Intronic
1085843446 11:80039865-80039887 CAAAATTTGGAGAAGGAGAAAGG + Intergenic
1085960064 11:81451173-81451195 CTGAACATGGAGAGGTAGCTGGG + Intergenic
1089171308 11:116513556-116513578 AAGAGTCTGGAGAGGGAGACAGG - Intergenic
1090225039 11:125064777-125064799 GAGAATCTAGAGAGGGGGATTGG + Intronic
1090386036 11:126358002-126358024 CAGGGGATGGAGAGGGAGCTTGG + Intronic
1090461278 11:126893692-126893714 CAGACGTGGGAGAGGGAGATTGG - Intronic
1090524409 11:127515738-127515760 CAGAATATGGGAAGGGTGAGAGG - Intergenic
1090803157 11:130187310-130187332 CAGAATACGGAGGGGCAGGTGGG - Intronic
1091479938 12:817485-817507 CAGCATTTGGAGAGGCAGATTGG + Intronic
1091482202 12:844684-844706 CAGAAGATGGGAATGGAGATTGG - Intronic
1092649731 12:10620967-10620989 CAGAATATAGTGATGGAGCTAGG - Intronic
1092769398 12:11883174-11883196 CAGAACCTGGAGAGGCAGCTGGG - Intronic
1094875558 12:34638947-34638969 TAGAATATGCAAAGGGATATTGG + Intergenic
1094877230 12:34663331-34663353 CAGAATGTGCAAAGGGATATTGG + Intergenic
1095169888 12:39021292-39021314 GAGAAGATAGAGAGAGAGATGGG + Intergenic
1095862177 12:46929857-46929879 AAGAAGATGGATGGGGAGATGGG - Intergenic
1096107225 12:49003481-49003503 TTAAATATGGAGAGGGAGAAGGG - Intronic
1096666538 12:53170088-53170110 GAGGATCTGGAGAGGCAGATTGG - Exonic
1096979188 12:55718669-55718691 AAGAAGTTGGAGAGGGAAATTGG - Intronic
1099148814 12:79082290-79082312 CAGACTGTTGAGTGGGAGATGGG - Intronic
1099310720 12:81018291-81018313 TAGAATATGGAAAAGGTGATGGG + Intronic
1099603740 12:84775125-84775147 AAGAATATGGAGAAAGAGAGGGG - Intergenic
1099868116 12:88310153-88310175 CAGAAGATGAAAAGGGATATTGG - Intergenic
1100438264 12:94591800-94591822 CAGGATAGCAAGAGGGAGATGGG - Intronic
1100491829 12:95087335-95087357 AAGAATTTGGTGAGGGTGATAGG + Intronic
1101379202 12:104199373-104199395 CAGAATGTGGAGAGGAGAATTGG - Intergenic
1101397315 12:104359717-104359739 CCGTCTATGGAGAGGGAAATAGG + Intergenic
1101702218 12:107184880-107184902 CAGCATATGAATTGGGAGATGGG - Intergenic
1102454535 12:113063510-113063532 CAGCACATGGAGAGCGACATGGG - Intronic
1102774290 12:115505300-115505322 GAGAAAATGGAGAGAGAGCTGGG - Intergenic
1102913056 12:116733112-116733134 CAGGATGTGGAGGGGGAGACAGG + Intronic
1103066209 12:117899713-117899735 TAGAATATGGCAAAGGAGATGGG + Intronic
1104125017 12:125838060-125838082 GAGAAAATGATGAGGGAGATGGG + Intergenic
1105342582 13:19541325-19541347 CAGAATATGGCTAAGGTGATGGG - Intergenic
1106416824 13:29552818-29552840 TAGAATGTGGAGTGGGAAATTGG - Intronic
1106772124 13:32971751-32971773 CAGAATATGGAATGAGAGACTGG + Intergenic
1106815372 13:33401669-33401691 GAGAAAATGGAGAGGGAGCTGGG - Intergenic
1109807247 13:67459652-67459674 CAGAAGATGAAGAAGGAAATAGG + Intergenic
1110107622 13:71697445-71697467 CAGAATATTCAGTGGGAGACAGG - Intronic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1111810634 13:93092797-93092819 CCTTATATCGAGAGGGAGATAGG + Intergenic
1112264742 13:97913038-97913060 CAGAATATGGATAGAGTGAGTGG - Intergenic
1112933491 13:104770387-104770409 CAGAATACGGAGAGTCAGAAGGG - Intergenic
1113196563 13:107814777-107814799 CAGAAGATGAACAGGGAAATGGG + Intronic
1113246750 13:108404918-108404940 CAGAATATGGCAATGGTGATGGG + Intergenic
1114318306 14:21526233-21526255 CAGACTGCGGAGATGGAGATCGG + Intronic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1115269621 14:31537403-31537425 CAAAATTAGTAGAGGGAGATGGG + Intronic
1115618480 14:35119007-35119029 CAGAAGCTGGAGAGGGATGTGGG + Intronic
1116516904 14:45815421-45815443 CCTAATATTCAGAGGGAGATAGG + Intergenic
1116519437 14:45831682-45831704 CCTAATATCCAGAGGGAGATAGG - Intergenic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1117276311 14:54197492-54197514 GAGGAAATGGAAAGGGAGATAGG + Intergenic
1117815599 14:59594362-59594384 CAGATGATGTGGAGGGAGATTGG - Intergenic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1119954658 14:78784147-78784169 TAGAATATGCTCAGGGAGATAGG + Intronic
1120393565 14:83939262-83939284 CAGAACATGGAGTGGCAGAGAGG + Intergenic
1120550085 14:85859664-85859686 CAAAATAAAGAAAGGGAGATGGG + Intergenic
1120996358 14:90421276-90421298 CAGTGTTTGAAGAGGGAGATTGG - Intergenic
1121552791 14:94814983-94815005 CAGAACCTGGAGAGAGAGACAGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1121884198 14:97527808-97527830 CAGAGTTTGGTGTGGGAGATAGG + Intergenic
1123668398 15:22628650-22628672 CAGAATGAGGAGGGAGAGATGGG - Intergenic
1124524377 15:30435111-30435133 CAGAATGAGGAGGGAGAGATGGG - Intergenic
1124534288 15:30531112-30531134 CAGAATGAGGAGGGAGAGATGGG + Intergenic
1124764360 15:32476499-32476521 CAGAATGAGGAGGGAGAGATGGG - Intergenic
1124774274 15:32572599-32572621 CAGAATGAGGAGGGAGAGATGGG + Intergenic
1126347155 15:47708332-47708354 CAGAATCAGGGGAGGGTGATAGG - Intronic
1126558271 15:50015244-50015266 AAGAAAATGAAGAGGGAAATTGG + Intronic
1127074332 15:55311017-55311039 CAGAATCAGGATATGGAGATTGG - Intronic
1127808902 15:62546134-62546156 CACAGTGTGGAGAGGGAGGTCGG + Intronic
1128317420 15:66669940-66669962 CTGAATATGGAGTGGGCGGTGGG + Intronic
1129089647 15:73135572-73135594 CAGAATAGGGAGACAGGGATGGG + Intronic
1129157862 15:73730001-73730023 CTGAATCTGGAGAGGGAGTTAGG + Intergenic
1130328119 15:82897560-82897582 CAGAATATGGCAAAGGTGATGGG + Intronic
1130400805 15:83551540-83551562 CAGAAGGTGGACAGGCAGATCGG - Intronic
1130568369 15:85018181-85018203 CAGTAGATGTAGAGGGATATAGG + Intronic
1131334459 15:91534407-91534429 CATAAAAAGGAGAGGGAGAATGG + Intergenic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1132420238 15:101659592-101659614 TAGGAGATGGAGAGGGAGACAGG - Intronic
1132988816 16:2782719-2782741 CAGATTACGGAGAGGGAAGTAGG + Intergenic
1133392751 16:5422760-5422782 AAGAAGATGGAGAGGGAGAAGGG + Intergenic
1133485510 16:6215025-6215047 AAGGAAATGGAGAGGGAGAGGGG + Intronic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133873825 16:9714272-9714294 CAGAGTGGGGAGAGGGAGATTGG - Intergenic
1135343664 16:21669578-21669600 GAGCATGTAGAGAGGGAGATGGG - Intergenic
1136009137 16:27351353-27351375 CAGAATATGGTAAAGGTGATGGG - Intronic
1136510834 16:30737464-30737486 CAAGATATGGACAGGGAGAATGG - Exonic
1137532116 16:49284309-49284331 CAGGACATAGAGAGGGAGTTAGG - Intergenic
1137641260 16:50032329-50032351 AAGAATATGTAGAGGGACAAGGG - Intronic
1137809199 16:51336597-51336619 AAGAAAATGGAGATGGTGATGGG - Intergenic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1139339984 16:66262249-66262271 CAGAATATGGTGAGGGAGCGAGG + Intergenic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1140170403 16:72598700-72598722 CAGACAATGGAGTGGGAGAAGGG + Intergenic
1141019305 16:80479975-80479997 AAGAAAAAGAAGAGGGAGATTGG + Intergenic
1141279574 16:82618842-82618864 ATGAATTTGGAGAGGGAGACAGG + Intergenic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143476763 17:7207600-7207622 CAGAAAATGGAAATGGAGGTTGG + Intronic
1144294831 17:13864081-13864103 AAGAATTTGTAGTGGGAGATAGG + Intergenic
1146828736 17:36047837-36047859 CAGTGTAGGAAGAGGGAGATGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148717336 17:49725104-49725126 AAGAAAAAGGAGAGGGAGATGGG - Intronic
1149123694 17:53201781-53201803 CATAATATGTAGAGGGAAAATGG + Intergenic
1150002538 17:61451087-61451109 CAGAATCTGGAAAGGGACAGAGG + Intergenic
1150030975 17:61735239-61735261 CAGAATATGGAAAGGGTTCTGGG + Intronic
1150703680 17:67469045-67469067 GAGAGTATGGAGAGGGATCTGGG + Intronic
1152315267 17:79576804-79576826 GAGAAGATGGAGATGGAGATGGG + Intergenic
1153231862 18:2945534-2945556 CAGCAGATTGAGTGGGAGATGGG - Intronic
1153241049 18:3031631-3031653 AATAATCTGGAAAGGGAGATTGG - Intergenic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1155581505 18:27313296-27313318 CAGATTTGGGATAGGGAGATGGG + Intergenic
1155588768 18:27400304-27400326 GAGAAAATGGAGAGGGATACCGG - Intergenic
1156658236 18:39312993-39313015 AAGAAAATGGGGAGGGAAATTGG + Intergenic
1156988805 18:43381291-43381313 CAAAGTATGGTGAGGGGGATAGG + Intergenic
1157372624 18:47130496-47130518 AAGGAGAGGGAGAGGGAGATGGG + Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157505750 18:48225266-48225288 GAGAAAAGGGAGAGGGAGAGGGG + Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158462202 18:57656282-57656304 CAGAATATCAAGAGAGAGACTGG - Intronic
1159753856 18:72338668-72338690 TAGAATAGGGAGAGAGAAATAGG - Intergenic
1160349761 18:78166713-78166735 CAGTATATGTAGATGGAGAGGGG + Intergenic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160940515 19:1618519-1618541 CAGAGTGAGGAGAGGGAGAGAGG - Intronic
1161251769 19:3284628-3284650 CGGGATAGGGAGAGGGAGATGGG + Intronic
1161536171 19:4819990-4820012 CAGAATATGGCAAGGGAGCCAGG + Intronic
1162015200 19:7841759-7841781 CAGCATAGGGAGATGGAGATGGG + Intronic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1165184877 19:34009337-34009359 CAGAATCTTGAGAGGGTGATGGG + Intergenic
1165424071 19:35736358-35736380 CAGAATAATGACAGGTAGATGGG + Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166244768 19:41517584-41517606 CATAATATATAGAGGGAGAGAGG - Intergenic
1168138751 19:54370261-54370283 CAGAAGATGGAAAGAGAAATGGG - Intronic
1168159275 19:54498236-54498258 CAGAAGATGGAAAGAGAAATGGG + Intronic
925265084 2:2561441-2561463 CAGAAGCTGGAGAGGCAGAAAGG + Intergenic
925557468 2:5147472-5147494 CAGAATATGTCCACGGAGATAGG + Intergenic
925647033 2:6045679-6045701 CAGAGTATTGAGAGGGAGCACGG + Intergenic
926376683 2:12236151-12236173 GAGAATAAGGAGAGAGAGAGAGG - Intergenic
926460732 2:13126556-13126578 CAGAACATGGAGAGAGACCTGGG - Intergenic
926864434 2:17342375-17342397 CAGAATAAGAACATGGAGATCGG + Intergenic
927023502 2:19041905-19041927 CAGAATTGGGAGTGGGAGTTAGG - Intergenic
927387347 2:22550228-22550250 AAGGAAAAGGAGAGGGAGATAGG + Intergenic
927463790 2:23322021-23322043 CAGAGTGTGCAGAGGGAGATGGG + Intergenic
928407453 2:31025387-31025409 CATATTATGGAGAGAGAGACGGG + Intronic
929334589 2:40725693-40725715 GAGAAGAAGGAGAGGCAGATAGG - Intergenic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930332547 2:50004115-50004137 AAGAAGATGGAGATAGAGATAGG + Intronic
930828978 2:55723425-55723447 CAGAATGTGGAGTGGGCAATTGG + Intergenic
932424438 2:71620172-71620194 CAGATTTTGGAGAGGGAGGGAGG + Intronic
932613309 2:73215529-73215551 GAGACTATGGAGATGGAGATAGG - Intronic
932719369 2:74126949-74126971 CAGAAGATGGATAGTGAAATTGG + Intergenic
934962429 2:98688442-98688464 CAGAATATGGCAAAGGTGATAGG + Intronic
935186608 2:100739881-100739903 TAGAATATGGTGAAGGGGATTGG + Intergenic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
936640777 2:114310669-114310691 AAGAATATAGAGAAAGAGATAGG - Intergenic
937162526 2:119778230-119778252 TAGAAAATGGAGAGGGAGAGAGG + Intronic
937452235 2:122011149-122011171 CAGAAAATGAAGAGCAAGATGGG + Intergenic
937721209 2:125099218-125099240 CAGTAGATGGTGGGGGAGATAGG - Intergenic
937732387 2:125249175-125249197 CAGAATATGTTGAGAGAGAAGGG + Intergenic
938417485 2:131115993-131116015 CAGAATGAGGAGAGGTAGACAGG + Intronic
938867487 2:135438170-135438192 CAGTATATAGAGAGAGATATAGG - Intronic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
939018347 2:136927955-136927977 GAGAAGTGGGAGAGGGAGATAGG + Intronic
939168655 2:138667655-138667677 CAGAATATGGGGTAGGAGATTGG + Intergenic
939714770 2:145570228-145570250 CAGCATAGAGAAAGGGAGATAGG + Intergenic
940051282 2:149467565-149467587 CAGAATCTGGTGGGGGAGAGGGG + Intronic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
942497301 2:176553239-176553261 GAGAAAATGGAGAGAGAGAGAGG - Intergenic
942955020 2:181763778-181763800 CAGAAGATTGAGAGAGAGGTGGG + Intergenic
942977786 2:182039800-182039822 CAGAATTGGGAGAGGGTGAGGGG - Intronic
943195764 2:184746698-184746720 CAGAGTCTGGAAAGGGTGATGGG - Intronic
943635409 2:190301469-190301491 CAGAGGAGGGAGAGGGAGTTGGG + Intronic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
945504289 2:210619231-210619253 CAGACTATGGAGCCAGAGATTGG + Intronic
946442657 2:219710031-219710053 GAGAATATGGAGGGGAAGGTTGG - Intergenic
946970468 2:225085084-225085106 CAGAATTTGGAGACAGAAATGGG - Intergenic
947132227 2:226940643-226940665 TAGATGATGGAGAGTGAGATAGG + Intronic
947907917 2:233779188-233779210 CAGAATATGGCAAAGGTGATGGG - Intronic
948108577 2:235435439-235435461 CAGAATATGGCAAAGGTGATGGG + Intergenic
948338750 2:237232154-237232176 AAGCATCTGGAGAGGGAGAGGGG - Intergenic
1169179726 20:3552955-3552977 CAGAATATGGCGAAGATGATAGG - Intronic
1169944219 20:10971755-10971777 CAGAATATGGCAAAGGTGATAGG - Intergenic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1170160606 20:13306540-13306562 CAGCAAATGGAGAAGGAGAAAGG + Intergenic
1171044133 20:21794634-21794656 CAGACTTTGGAGGGGGAGTTAGG - Intergenic
1171333810 20:24364869-24364891 CAGAATATGAAGAAGGACAGTGG - Intergenic
1172090941 20:32432200-32432222 CAGCAGATGGAGAGGCACATGGG + Intronic
1172105936 20:32517354-32517376 CAGCAGCTGGAGAGGGAGAAGGG + Intronic
1173362626 20:42358407-42358429 TACAATTTGGTGAGGGAGATAGG + Intronic
1173368909 20:42417056-42417078 TAGAAGCTGGAGAGGGAGAAAGG + Intronic
1174666424 20:52262122-52262144 CAGAATTTACAGAGGGAAATTGG - Intergenic
1175361658 20:58415943-58415965 CAGAGTAGGGAGAGGAAGGTTGG + Intronic
1177668435 21:24192605-24192627 CAGAAGATGGTGTGGCAGATGGG - Intergenic
1178110056 21:29360906-29360928 CAGGATATGGGGATGGGGATTGG - Intronic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1180760231 22:18196789-18196811 CGGAATATGGAGGGGGAACTTGG + Intergenic
1180770543 22:18381087-18381109 CGGAATATGGAGGGGGAACTTGG + Intergenic
1180775437 22:18427907-18427929 CGGAATATGGAGGGGGAACTTGG - Intergenic
1180808507 22:18738962-18738984 CGGAATATGGAGGGGGAACTTGG - Intergenic
1180828486 22:18884045-18884067 CGGAATATGGAGGGGGAACTTGG + Intergenic
1181071436 22:20343926-20343948 CGGAATATGGAGGGGGAACTTGG - Intergenic
1182113397 22:27740503-27740525 CAGAATATGGCAAAGGTGATGGG + Intergenic
1182854031 22:33501491-33501513 TTGAATATAGAGTGGGAGATGGG + Intronic
1184036882 22:41922626-41922648 CAAAAGATGGGGTGGGAGATGGG + Intergenic
1184036912 22:41922710-41922732 GAGAAGATGGGGTGGGAGATGGG + Intergenic
1184036923 22:41922741-41922763 GAGAAGATGGGGTGGGAGATGGG + Intergenic
1184036931 22:41922771-41922793 GAGAAGATGGGGTGGGAGATGGG + Intergenic
1184345781 22:43911808-43911830 CAGAAGCTGGAGGGAGAGATGGG - Intergenic
1184411116 22:44327080-44327102 CTGAATATGGGGAAGCAGATCGG + Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
1203232378 22_KI270731v1_random:122259-122281 CGGAATATGGAGGGGGAACTTGG + Intergenic
949837526 3:8285523-8285545 CAGAAGGTGGAAAGGGAGGTAGG - Intergenic
950078715 3:10206087-10206109 AAGAAAATGCAGAGGGAGCTGGG + Intronic
950801468 3:15555070-15555092 AACAAGATGGTGAGGGAGATGGG + Intergenic
951222600 3:20084494-20084516 AGGAATAGGGAGATGGAGATGGG - Intronic
951335853 3:21420889-21420911 CAGACAATGCAGAGGGAAATAGG + Exonic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
955275047 3:57539331-57539353 GTGAAGATGGAGAGGGAGGTGGG - Intronic
955498388 3:59560485-59560507 CAGAATATGGCAAAGGTGATAGG - Intergenic
955699989 3:61672760-61672782 GAGAAGAGGGAGAGGGAGAGAGG + Intronic
955735188 3:62031463-62031485 CATGATATGGAGAGGTAGACAGG + Intronic
955987087 3:64584752-64584774 TAGCATATAGAGAGAGAGATGGG - Intronic
956071631 3:65458975-65458997 TAGTATATGGAGAGAGATATGGG + Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
958133008 3:89453945-89453967 CAGAAGAGAGAGAGGGAGACAGG - Intronic
959401063 3:105902948-105902970 CAGAAGATGGAAAGGGGGAAAGG - Intergenic
960073272 3:113455632-113455654 CAGAATATGCAGATGAAAATGGG - Intronic
960148683 3:114230468-114230490 CAGAGTCTGGAGTGGGGGATGGG + Intergenic
960447049 3:117762049-117762071 CATAATGAGGAAAGGGAGATAGG - Intergenic
960669643 3:120143965-120143987 CAGGACATGAACAGGGAGATGGG + Intergenic
961858042 3:129892943-129892965 GAGAATATGTAGTGGGAGGTGGG - Intronic
962123390 3:132588112-132588134 CAAAATTTGGAAAGTGAGATGGG - Intronic
962648676 3:137466006-137466028 CAGAATATTGAGGGTGAGAAAGG + Intergenic
962664955 3:137644608-137644630 TAGAGAATGGGGAGGGAGATGGG - Intergenic
963693899 3:148540586-148540608 CAGAAAATGGAGCTGGAGTTGGG + Intergenic
964521333 3:157572316-157572338 CAGAAAAAGGAAAGAGAGATTGG + Intronic
964964950 3:162481272-162481294 CAGAATAGAGAGAGAGAGAGAGG - Intergenic
965951448 3:174312832-174312854 CAGCTTATGGAGAGAGAGGTAGG - Intergenic
966401168 3:179548192-179548214 GAGAAAATAGAGAGAGAGATAGG + Intergenic
966903915 3:184508167-184508189 CAGAAGGTGGAGAGGAAGCTTGG + Intronic
966959628 3:184921956-184921978 CAGAATATATAGAGGGATCTTGG - Intronic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
968282827 3:197490058-197490080 CAGAAAAAGTAGAGGGAGCTGGG - Intergenic
969231310 4:5833557-5833579 GAGAAAATGGAGAGAGAGAGAGG - Intronic
971116311 4:23649795-23649817 CAAAGGATGGAGATGGAGATAGG + Intergenic
971487322 4:27173405-27173427 CAGAATTTGATGAGGTAGATGGG - Intergenic
971832229 4:31710014-31710036 TAGAATATGTAGAGAAAGATAGG - Intergenic
972162819 4:36245936-36245958 GAGAATTTGGAGAGGGAAAAGGG - Intergenic
973315046 4:48750729-48750751 AAAATTATGGAGAGGGAGCTGGG + Intronic
974365970 4:60949333-60949355 TAGTATATGGCTAGGGAGATAGG - Intergenic
974573028 4:63679945-63679967 CAGAATATTGGGAGGGATTTAGG + Intergenic
975098317 4:70483264-70483286 CAGAGTAAAGTGAGGGAGATGGG - Intergenic
975194828 4:71511770-71511792 CAGAATCTGGGAAGGGTGATGGG - Intronic
975474461 4:74807264-74807286 CACAATATAGAGGAGGAGATGGG + Intergenic
975621335 4:76299850-76299872 GATAATATGGAGAGTGACATGGG + Intronic
975644067 4:76528848-76528870 AAGAATAGGGAGAGGAAGACCGG - Intronic
975870032 4:78769761-78769783 CAGCAAATGGAGTGGCAGATAGG - Intergenic
977652265 4:99484605-99484627 CAGAATACTGAGAGGGAGCATGG - Intergenic
977680297 4:99791506-99791528 CAGAATATGCTAAGGGAGACGGG + Intergenic
978505429 4:109451221-109451243 CTGTATATAGAGAGGGAGACAGG + Intronic
979422033 4:120516300-120516322 CAGAGTATGTAGAGGCACATGGG - Intergenic
981265398 4:142777241-142777263 CAGAATATGGCAAAGGTGATAGG + Intronic
981288455 4:143046706-143046728 CAGCATCTGGAGAGGAGGATGGG + Intergenic
984314689 4:178112966-178112988 CAGAATATAGGGAGGGAACTGGG + Intergenic
984505411 4:180611216-180611238 GAGAATATTGTGAGGAAGATGGG + Intergenic
984648536 4:182244602-182244624 GAGAATATGAAGAGGAAGACGGG + Intronic
985241940 4:187939625-187939647 CATAACAGGGAGAGGGAGATTGG + Intergenic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
988829450 5:34973122-34973144 CAGATGATGCAGTGGGAGATAGG - Intergenic
989579865 5:43022152-43022174 CAGAAAAAAGAGAGAGAGATAGG + Intergenic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
994217675 5:97157709-97157731 GAGGAAATAGAGAGGGAGATGGG - Intronic
994226391 5:97255764-97255786 GAGTATATAGAGAAGGAGATGGG + Intergenic
994392444 5:99203575-99203597 CAGAATATTCAGAGGAAGAGAGG - Intergenic
996838666 5:127822542-127822564 CAGACTATGAAAAGGGAGAGGGG + Intergenic
998072465 5:139208783-139208805 CAGAATGTGGAAAGGGAGAGGGG + Intronic
998657773 5:144201313-144201335 CAGGATTTGGTGAGGGAGATGGG - Intronic
998747988 5:145283511-145283533 CAGCAAATGCAGAGGGAGAGGGG - Intergenic
999310663 5:150549661-150549683 CAGAATCTGGAAAGGGAGAAAGG - Exonic
1000446729 5:161331431-161331453 CAGAATATGGAGAGGACTCTAGG + Intronic
1000981651 5:167823204-167823226 CAAAATATGGACAGAGAGGTAGG - Intronic
1001083808 5:168685939-168685961 GAGAGAATGGGGAGGGAGATAGG + Intronic
1001136785 5:169109052-169109074 CAGCATATGGAAAAGGGGATGGG + Intronic
1001492869 5:172168116-172168138 CAGAATAAAGACAGGGAAATAGG - Intronic
1001645968 5:173282662-173282684 AAGAAGAGGGAGAGGGAGAATGG + Intergenic
1002006743 5:176239948-176239970 AAGAATATGGGGAGAGAGAATGG + Intronic
1002219633 5:177670688-177670710 AAGAATATGGGGAGAGAGAATGG - Intergenic
1003010917 6:2426903-2426925 AAGAATAGAGAGAGAGAGATGGG + Intergenic
1004411597 6:15386241-15386263 AAGAACAGGGAGAGGGAGAGGGG - Intronic
1004979721 6:21009830-21009852 CAGAAAGTGGAAAGGGAGGTAGG + Intronic
1005053794 6:21710870-21710892 CAGATAATGCAGAGGTAGATAGG - Intergenic
1005589753 6:27311651-27311673 CAGAAAAGGGAAAGGGAGGTTGG - Exonic
1006185516 6:32179569-32179591 CAGGAGATGAAGAGGGAAATGGG + Intronic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1009047610 6:58248847-58248869 CATAATATGCAGAGGGAGAGAGG + Intergenic
1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG + Intergenic
1009224074 6:61007072-61007094 CATAATATCGAGAGGGAAAGAGG + Intergenic
1009366930 6:62863453-62863475 AATAATATGGAGGGGGAGAGAGG - Intergenic
1009372650 6:62926484-62926506 CAGAATTTGGTGAAGGTGATGGG - Intergenic
1010002205 6:70958486-70958508 CAGAATCTGAAGAGGAAGTTAGG - Intergenic
1010277068 6:73981107-73981129 CAGGGTAGGGAGAGGGAGCTGGG - Intergenic
1011164474 6:84430756-84430778 CAGAAGCTGGGGTGGGAGATGGG + Intergenic
1011736312 6:90313896-90313918 AAGAATATGCAGAAGGGGATGGG - Intergenic
1012416363 6:99018171-99018193 CAGACTAGAGAAAGGGAGATGGG - Intergenic
1012517356 6:100077845-100077867 GAGAATATGAAGGGGGTGATGGG + Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1013599855 6:111693713-111693735 CAGAGCAGGGAGAGGGAGAGTGG - Intronic
1013608592 6:111773555-111773577 CAGAGGAGGGAGAGGGAGAGGGG + Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014790760 6:125669249-125669271 CAGCATGTGGAGAGAGAGATAGG - Intergenic
1014831092 6:126103845-126103867 CAGAATATAGCAAAGGAGATAGG - Intergenic
1015295537 6:131587489-131587511 AAAAATATAGATAGGGAGATGGG + Exonic
1015429746 6:133117088-133117110 CAGAATATGGCAAAGGTGATGGG + Intergenic
1016048355 6:139504041-139504063 TAGAATATGAACAGAGAGATAGG - Intergenic
1016104271 6:140142574-140142596 CAAACCATGGAGAGGGATATGGG + Intergenic
1017596267 6:156031798-156031820 CAATAAATTGAGAGGGAGATTGG + Intergenic
1017929919 6:158943410-158943432 AAGAATATGGAAAGAGAGAGGGG - Intergenic
1018628461 6:165802780-165802802 TAGAATTTGGATAGGGAGAGGGG - Intronic
1018682060 6:166272387-166272409 CAGAAGATGGCAAGGGCGATGGG + Intergenic
1018724705 6:166602969-166602991 GAGAATCTGGAGAGAGAGAGAGG + Intronic
1020483523 7:8692070-8692092 CAGAAGATGGTCAGGGAGGTTGG + Intronic
1020937088 7:14480107-14480129 CAGAATAGAGAAAGGGAGAGAGG + Intronic
1021372193 7:19862640-19862662 GAGAAGTTGGGGAGGGAGATTGG - Intergenic
1021418327 7:20416285-20416307 CAGAGTGTGGAGTGGGAAATCGG + Intergenic
1021494418 7:21258812-21258834 GAAAACATGGAGAGGGAGAAGGG - Intergenic
1022175480 7:27868411-27868433 AGGAATCTGGAGAGGGGGATGGG - Intronic
1023044015 7:36196415-36196437 AAGGAGAGGGAGAGGGAGATGGG - Intronic
1023215373 7:37856874-37856896 TAGAATATTGAAAGGGACATAGG + Intronic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1023956071 7:44887629-44887651 CTGAATATGGAGGGACAGATTGG + Intergenic
1024516390 7:50262602-50262624 AAGAAGAAGGGGAGGGAGATGGG - Intergenic
1024956689 7:54928135-54928157 GAGAAGATAGAGAGAGAGATAGG + Intergenic
1025607103 7:63047354-63047376 CTGAAGATGGTGAGGGAGGTTGG - Intergenic
1026003306 7:66580495-66580517 GAGAGGTTGGAGAGGGAGATAGG - Intergenic
1026105458 7:67417433-67417455 CAGAAGAAGGAGAGAGAAATGGG + Intergenic
1026451022 7:70529730-70529752 CAGAATTTGGAGAGGAACAATGG + Intronic
1027210049 7:76139094-76139116 GAGAGGCTGGAGAGGGAGATAGG - Intergenic
1027569222 7:79842321-79842343 CAGAATATGGAAGAGGAGAAAGG - Intergenic
1028623636 7:92852224-92852246 CAGAAAACAAAGAGGGAGATGGG + Intergenic
1028829815 7:95314768-95314790 CAGCAAATGGAAAGGGAGAAAGG + Intronic
1030345337 7:108427005-108427027 TGGAATATGGAGAAGTAGATTGG - Intronic
1031550339 7:123103763-123103785 TAGAATATGGAGATGTAGAAAGG + Intergenic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1031770926 7:125841354-125841376 CAGAAAGTGGAGAGTGAGAATGG + Intergenic
1032306862 7:130742116-130742138 AACAATGTGGACAGGGAGATAGG + Intergenic
1032342019 7:131082742-131082764 CAGAACATGGCGAGAGTGATGGG + Intergenic
1032451780 7:132037486-132037508 TAGAAAATGGAGATGGAGAATGG - Intergenic
1032968318 7:137129342-137129364 CAGAATATGAAGTTGGAGAGAGG - Intergenic
1033266843 7:139894302-139894324 CAGAAGATGGTGTGGGAGAAGGG + Intronic
1033419302 7:141192326-141192348 CAGGGTGTGGAGGGGGAGATAGG + Intronic
1033529059 7:142244985-142245007 CACAATAGGGAGAGGAAGAAAGG + Intergenic
1034286459 7:149886497-149886519 CAGAGTATTGAGAGGGACACTGG + Intergenic
1035042047 7:155936069-155936091 CAGCATATGGGGGTGGAGATTGG + Intergenic
1036514706 8:9433106-9433128 CAGGAGATGGAAAGGGAAATAGG + Intergenic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037340131 8:17835541-17835563 AAGAACCTGGAGAGGGAGAAAGG - Intergenic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1037686170 8:21141440-21141462 CAGGAGATGGAGGGGGACATGGG + Intergenic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1038167404 8:25099126-25099148 CAGGATTTGGAGAGGTAGACTGG + Intergenic
1038741147 8:30218243-30218265 GAGAAGATGGAGACAGAGATTGG + Intergenic
1038935801 8:32249994-32250016 CAGAATATGGGAAGGCAGTTTGG + Intronic
1040005392 8:42616641-42616663 CAGAGAATGGAGAGCCAGATGGG - Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042683605 8:71413323-71413345 CTGAATATTGAGAGGGCAATTGG - Intronic
1042852304 8:73227915-73227937 CTGAGTAAGGTGAGGGAGATGGG - Intergenic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1044407821 8:91850158-91850180 CAGAATCTGGAAAGGGTGGTTGG + Intergenic
1044620519 8:94186908-94186930 CAGAGTATAGAGTGGGAGACAGG - Intronic
1045629695 8:104104013-104104035 CTGAAGATGGAGGAGGAGATGGG + Intronic
1046138683 8:110062382-110062404 CTGAAGCTGGATAGGGAGATGGG - Intergenic
1046286632 8:112101564-112101586 GAGACTATGGATAGGGAGATAGG - Intergenic
1046417130 8:113932122-113932144 CAGGAGCTGGAGAGGGAAATGGG + Intergenic
1047246818 8:123153186-123153208 TAGAATATGTAGAGTGTGATGGG + Intergenic
1047701927 8:127457261-127457283 CAGAATATGGCAAAGGTGATGGG + Intergenic
1047979006 8:130160380-130160402 CAGAATGTGTAAAGGGAGAAAGG - Intronic
1048651972 8:136487869-136487891 CAGAACATGAAGTGGGAGGTGGG + Intergenic
1048685183 8:136897000-136897022 CAGAAAATGGAGACTGGGATTGG + Intergenic
1050760064 9:9058153-9058175 CAGAATATAAAGAGGGAATTAGG + Intronic
1051635002 9:19173584-19173606 CAGAATTTGGGGAGGTAGGTGGG + Intergenic
1053308224 9:36999174-36999196 CAGGATTTGGAAAGGGAGAGAGG - Intronic
1053399867 9:37809532-37809554 CAGAATAAAAAGAGGGACATAGG + Intronic
1054878037 9:70116889-70116911 GAAAATAGAGAGAGGGAGATGGG - Intronic
1055312541 9:74997983-74998005 GGGAAAGTGGAGAGGGAGATTGG - Intronic
1055486757 9:76763743-76763765 CCCAATATGGAGAAGGAGAGGGG + Intronic
1055605485 9:77966151-77966173 CAGTGTTTGGAGGGGGAGATAGG + Intronic
1055787203 9:79883811-79883833 AAGAGAATGGAGAGGGAGAAGGG + Intergenic
1057158293 9:92864782-92864804 CAGAGTAGGGAGGGGGAGTTGGG - Intronic
1057700057 9:97357396-97357418 CAGAGTGTGGTGAGGGAGTTGGG - Intronic
1057799578 9:98182075-98182097 CAGAATCTGGAGGAGGAGAGAGG - Intronic
1058407784 9:104696549-104696571 AAGAGGATGGAGAGGAAGATAGG - Intergenic
1058815923 9:108682820-108682842 GAGATCATGGAGAGGGAGGTGGG - Intergenic
1058853042 9:109032059-109032081 CAGAACTGGGAGAGGGAGAGAGG - Intronic
1060565837 9:124590900-124590922 AAGAAAATGGAGAGGGGGATGGG - Intronic
1060859738 9:126944560-126944582 GAGACTATGGGGAGGGAAATTGG + Intronic
1061260073 9:129475337-129475359 CAGAGAATGGGGAGGGAGAGGGG + Intergenic
1061625567 9:131838936-131838958 CAGGGTGTGGAGAGGGAGAGGGG + Intergenic
1061746647 9:132745112-132745134 CAGCAGATGGAAGGGGAGATCGG - Intronic
1062236046 9:135508144-135508166 CAGAATGTGGAGAGGCACAGAGG + Intergenic
1185815350 X:3150037-3150059 GTGAAGATGGAGATGGAGATTGG - Intergenic
1187060130 X:15778748-15778770 CAGAAGAGAGAGAGAGAGATGGG + Intronic
1187124146 X:16437720-16437742 CAGCATATGGATAGGGAGGTGGG + Intergenic
1187442517 X:19332873-19332895 CAGAAGGTGGTGAGGGAGACTGG + Intergenic
1187709716 X:22040991-22041013 CAAGAGATGGAGAGGGAGAATGG + Intronic
1188034712 X:25304670-25304692 ATGAATTTGGAGAGGTAGATGGG + Intergenic
1189067384 X:37824807-37824829 AAGAAATAGGAGAGGGAGATTGG - Intronic
1189129693 X:38485392-38485414 CAGCATGGGGAGAGGCAGATTGG + Intronic
1189198087 X:39168407-39168429 CAGCTGATGGAGAGGGGGATAGG - Intergenic
1189203764 X:39220166-39220188 GTGAATATGGAGACAGAGATTGG - Intergenic
1189591658 X:42518775-42518797 CAGAATATGGCAAAGGCGATGGG - Intergenic
1190129748 X:47736149-47736171 TAGAATATGGCGAAGGTGATGGG + Intergenic
1190441724 X:50481621-50481643 CAGAATATGGCAAAGGTGATGGG - Intergenic
1190739927 X:53281851-53281873 CAGAAAATTGAGATGGAGAGAGG + Intronic
1191641924 X:63435133-63435155 CACAAGAAGGAGAGGGAAATGGG + Intergenic
1191831527 X:65420436-65420458 CAGAATCTGGATGGGCAGATTGG + Intronic
1192025100 X:67441839-67441861 GTGAAAGTGGAGAGGGAGATGGG - Intergenic
1192341871 X:70269620-70269642 AAGAGGATGGAGAGGGGGATTGG - Intronic
1192429417 X:71102258-71102280 GACGATATGGGGAGGGAGATGGG + Exonic
1193061385 X:77211848-77211870 CAAAATATGGACAGGAAGAAAGG - Intergenic
1193077589 X:77371780-77371802 CAGAATATTGACAGCCAGATAGG + Intergenic
1193294463 X:79818526-79818548 CAGAATATGGATAGGGAGCTGGG - Intergenic
1193497792 X:82236092-82236114 CAGAATATGGATAGGAATAAAGG - Intergenic
1193721256 X:84990187-84990209 CAGAAAATGGGAAGGGAGCTGGG + Intergenic
1195425299 X:104722453-104722475 GAGGATATTGAGAGGGAGACAGG + Intronic
1195622935 X:106975999-106976021 AAAAATGTCGAGAGGGAGATGGG - Intronic
1195707789 X:107750575-107750597 CAGAACAAGGAGAGAGAGCTGGG + Intronic
1196744049 X:119052494-119052516 GAGAATATGAAGAGGCTGATGGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1197329763 X:125139241-125139263 CAGAATATGAAGTGAGAGAATGG + Intergenic
1197728786 X:129793596-129793618 CAGAATATGGGGGTGGAGGTAGG - Intronic
1198588144 X:138145786-138145808 CAGAATAAGTAGAGGAAGAGAGG - Intergenic
1199497629 X:148470923-148470945 CAGAATTTGAAGAGGAAGTTGGG + Intergenic
1199511376 X:148626739-148626761 GAGAGAAAGGAGAGGGAGATTGG - Intronic
1199537270 X:148916790-148916812 CAAAACATGGAGAGAGAGAAAGG - Intronic
1200341864 X:155406072-155406094 CAGAATATAGAGAAATAGATGGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1201265948 Y:12206689-12206711 GTGAAGATGGAGATGGAGATCGG + Intergenic
1202589754 Y:26470342-26470364 CAGAATATGGCTAAGGTGATGGG + Intergenic