ID: 967769703

View in Genome Browser
Species Human (GRCh38)
Location 3:193321237-193321259
Sequence CCCAGTAGATCCTAAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967769703_967769705 -2 Left 967769703 3:193321237-193321259 CCTGCTTCTTAGGATCTACTGGG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 967769705 3:193321258-193321280 GGCCTACTTTGCACCTACCCAGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967769703 Original CRISPR CCCAGTAGATCCTAAGAAGC AGG (reversed) Intronic
901966048 1:12867284-12867306 CCCATAAGATCCAAACAAGCTGG - Intronic
901981442 1:13037664-13037686 CCCATAAGATCCAAACAAGCAGG - Intronic
902000643 1:13191261-13191283 CCCATAAGATCCGAACAAGCAGG + Intergenic
902019874 1:13336957-13336979 CCCATAAGATCCGAACAAGCAGG + Intergenic
906260842 1:44388491-44388513 AGCTGTAGATCCTAGGAAGCTGG + Intergenic
906889647 1:49695071-49695093 CCCACTAACTCCTAAGAAGTGGG - Intronic
912870664 1:113302162-113302184 ACCAGTAGAACCAAAGAAACAGG + Intergenic
915960241 1:160260743-160260765 CCCACTATATCCTAAAAAGTCGG + Intronic
916880988 1:169019269-169019291 TCCAGTATAACCTAACAAGCTGG - Intergenic
918884931 1:190180168-190180190 CCCATTAGATCCTTTGAAGTAGG - Intronic
924056976 1:240133506-240133528 CCATGGAGATCCAAAGAAGCTGG - Intronic
1063175171 10:3544280-3544302 CACAGCAGATCCTAAGACACAGG + Intergenic
1063418929 10:5895742-5895764 CCCAGGACATCCTTAGAAGCCGG - Intronic
1066045520 10:31592164-31592186 CCCAGCAAATCCTAGGAAGGTGG - Intergenic
1068735696 10:60411028-60411050 CCCAGTGGATCCTTGGTAGCTGG - Intronic
1071878191 10:89865518-89865540 CCCAGAAGATAGTGAGAAGCAGG + Intergenic
1072425153 10:95323872-95323894 CTCAGTTGATCCCAAGTAGCTGG - Intronic
1074813781 10:117129904-117129926 CCAAGTAAATCCTCAGCAGCTGG + Intronic
1075677294 10:124304293-124304315 CCCAGGTGATCCTATGAAGGTGG + Intergenic
1082557171 11:54576474-54576496 CCCAGTAGTCACTCAGAAGCAGG - Intergenic
1082620062 11:55409484-55409506 CCCAGTAGTCAATAAGAAGCAGG + Intergenic
1082684265 11:56219353-56219375 CCCAGTAGTTTCTCAGGAGCAGG - Intergenic
1084407070 11:68980263-68980285 ACCAGTAGATGCTCAGAGGCAGG + Exonic
1084785081 11:71437497-71437519 CCCAGCACATCCTAGGAGGCAGG + Intronic
1084893562 11:72249662-72249684 CCCAGGAAGTCCTAAGAAGTGGG - Intergenic
1086614605 11:88801228-88801250 CCATGTAGATACTGAGAAGCTGG + Intronic
1091213248 11:133882525-133882547 CCCAGTAGACATTCAGAAGCAGG + Intergenic
1091644293 12:2262159-2262181 CCCAGGAGATGCTAAGATGCAGG + Intronic
1092844136 12:12568460-12568482 CACAGTATCTTCTAAGAAGCTGG + Intergenic
1099022845 12:77427594-77427616 CCCAGTAGCTATTCAGAAGCAGG + Intergenic
1099216917 12:79864222-79864244 CCCAGTAGTTACTCAGGAGCAGG - Intronic
1105564803 13:21534287-21534309 ATCACTTGATCCTAAGAAGCTGG - Intronic
1106759019 13:32849579-32849601 TCCACTAGACCCTGAGAAGCAGG - Intergenic
1109210617 13:59531351-59531373 CCCAGCTGATTCTAAGGAGCAGG - Intergenic
1116736659 14:48700018-48700040 CCCAGTAGTTACTCAGGAGCAGG - Intergenic
1117196103 14:53341550-53341572 CCGAGTAGGTCCAAAGAGGCCGG + Intergenic
1117613775 14:57511389-57511411 TCCAGGAGCTCCTAATAAGCAGG - Intergenic
1118007891 14:61581614-61581636 GCCAGTTAATCCTCAGAAGCAGG - Intronic
1121433901 14:93906299-93906321 CCCACAAGTTCCTAAGAAACTGG - Intergenic
1125313229 15:38402983-38403005 CCCACTCCATCCTAAGAATCTGG - Intergenic
1125573173 15:40736650-40736672 ACCAGTGGAACCTAAGAAGAGGG + Intronic
1126205048 15:46035896-46035918 AGCAATTGATCCTAAGAAGCAGG - Intergenic
1126856579 15:52845213-52845235 CCCAGCAGATCCTAGCAAGGAGG + Intergenic
1127452296 15:59128802-59128824 CCCAGTAGATATTCAGGAGCAGG + Intergenic
1135544011 16:23353862-23353884 CCCAGGAGATCCTGAGACACGGG - Intronic
1137370366 16:47899720-47899742 CCCAGTAGTTATTCAGAAGCAGG - Intergenic
1137703685 16:50518686-50518708 CACAGTAGATCCTCAGCACCTGG - Intergenic
1137909649 16:52363686-52363708 CCCAGAAGACCCCAAGAAGCTGG + Intergenic
1138085706 16:54132008-54132030 ACCAGTAGATCCTCAGAGCCTGG + Intergenic
1141029727 16:80577357-80577379 CCCACTTGTTCCTAAGAACCTGG - Intergenic
1142346211 16:89555590-89555612 CCCAGAGGAGCCTAAGAAGATGG - Intronic
1144115933 17:12090486-12090508 CGTTGTAGTTCCTAAGAAGCAGG - Intronic
1145297751 17:21606476-21606498 CCCAGTTTATTCTATGAAGCTGG + Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1150961230 17:69914549-69914571 CCCAGCAAATCCCAAGTAGCTGG - Intergenic
1151596559 17:75081710-75081732 CCAAGTAGAGCCAAAGAACCTGG + Intergenic
1153282013 18:3423564-3423586 CTCAGTAGCTCCTGAGTAGCTGG - Intronic
1153444484 18:5156037-5156059 CCCAGGAGTTCCGAAGCAGCTGG + Intronic
1161365802 19:3878781-3878803 CCCAGTATATTCTAATAAGGAGG + Intergenic
926120277 2:10237934-10237956 CCCAGTGCGTCCTGAGAAGCAGG - Intergenic
927116713 2:19911064-19911086 CCAGGTAGATCCTAAGTTGCTGG - Exonic
927660284 2:24987608-24987630 CCCAGTAGTTCCTAGGCATCTGG + Intergenic
928830822 2:35480517-35480539 CCCAGTAGTTGTTCAGAAGCAGG - Intergenic
932056639 2:68452220-68452242 ACCAGTAGTTCCTAACAAGAGGG + Intergenic
932780824 2:74557273-74557295 CCCAGGAAGTCCTAAGAAGTGGG + Exonic
937582086 2:123499311-123499333 CCCAGTAGATCCAATGGTGCTGG - Intergenic
938661879 2:133495241-133495263 CCCAGGAGATCCTGAGAACATGG - Intronic
939077938 2:137625775-137625797 CCTAGTAGATCCCTGGAAGCAGG - Intronic
940437096 2:153668545-153668567 CCAAGTAGATCTTCAGAAGGAGG + Intergenic
940812824 2:158264758-158264780 CCAAATAGATACTAAAAAGCAGG + Intronic
940893681 2:159059768-159059790 CCTAGGAGATCCTAGGAGGCTGG - Intronic
940962320 2:159798938-159798960 GCCAGTAGATCCAAAGAAGAAGG - Intronic
941100438 2:161289060-161289082 CCCAGTAGTTATTCAGAAGCAGG - Intergenic
943074437 2:183177597-183177619 CCCAGTAGTTATTAAGGAGCAGG + Intergenic
945409989 2:209496697-209496719 CCCAGTACATTCTTAGAAACAGG - Intronic
1168873479 20:1151976-1151998 GCCAGTATGTGCTAAGAAGCTGG + Intronic
1170800131 20:19583826-19583848 CCGAGCAGATCCTAAGATGGAGG - Intronic
1174017798 20:47502418-47502440 CCCAGAAGCTGCTAAGGAGCCGG - Intronic
1178477082 21:32946458-32946480 CCCAGTAGAAGCAAGGAAGCTGG + Intergenic
1180837567 22:18937944-18937966 CTCTGTAAATCCTAGGAAGCAGG + Intergenic
1181063499 22:20293574-20293596 CTCTGTAAATCCTAGGAAGCAGG - Intergenic
1181723021 22:24790606-24790628 CCGAGTAGCTCCCAAGTAGCTGG + Intergenic
1182350513 22:29696653-29696675 CCCTGTAGACCCTAAGTGGCTGG - Exonic
1203287660 22_KI270734v1_random:163243-163265 CTCTGTAAATCCTAGGAAGCAGG + Intergenic
956150529 3:66237314-66237336 CCCAGTAGATTCTAATGTGCAGG - Intronic
956166692 3:66402767-66402789 CTCAGTGGATCCTAACAGGCCGG + Intronic
960287883 3:115850002-115850024 TCCAGTATGTCCTAACAAGCAGG - Intronic
967356310 3:188575820-188575842 CCCACATGATCCTAAGAGGCAGG - Intronic
967769703 3:193321237-193321259 CCCAGTAGATCCTAAGAAGCAGG - Intronic
967994165 3:195154231-195154253 CCCAGTAGATAGAAAGAACCTGG + Intronic
969056153 4:4404153-4404175 CCCAGGTGATCCTAAGAGGCCGG - Intronic
972755842 4:42044944-42044966 CCCAGTAGTCACTCAGAAGCAGG - Intronic
975287205 4:72634599-72634621 CCCAGTAGTCACTGAGAAGCAGG + Intergenic
976182787 4:82414977-82414999 CCCAGTGGTTCCTAAGCATCTGG + Intergenic
977783876 4:101009963-101009985 TGCAGTTTATCCTAAGAAGCAGG - Intergenic
979554702 4:122031936-122031958 CCCAGTAGTTCTTCAGGAGCAGG + Intergenic
981612104 4:146604808-146604830 CCCAGTAAATACTATGAAGTAGG - Intergenic
982529410 4:156520471-156520493 CCCAGTAGTTCCTATGTGGCAGG + Intergenic
983092779 4:163524269-163524291 CCCTGTAGGTCCTTAGAAGTTGG + Intergenic
983486773 4:168341619-168341641 CCCAGTAGTCACTCAGAAGCAGG + Intergenic
984354462 4:178639867-178639889 CCCAGTAGTCCCTCAGGAGCAGG - Intergenic
984580170 4:181502014-181502036 CCTAGTAGAACCCAAGAAGGTGG + Intergenic
985027379 4:185751569-185751591 CCCAGTAGGTCCTCAGAAGATGG + Intronic
989660719 5:43794497-43794519 CCCAGTAGTCACTCAGAAGCAGG - Intergenic
991638736 5:68732761-68732783 CCCAGTGCATCTTCAGAAGCTGG - Intergenic
997809157 5:136950451-136950473 CCCAGTAGTTATTCAGAAGCAGG + Intergenic
999526256 5:152409488-152409510 CACAGTAGCTCCCAAGTAGCTGG + Intronic
999570709 5:152916945-152916967 CCCAGTAGTCGCTCAGAAGCAGG + Intergenic
1004997480 6:21207707-21207729 CCATGTATATCCTATGAAGCAGG - Intronic
1006671999 6:35735451-35735473 CCCAGTACACCCTAGGCAGCAGG - Intergenic
1009817978 6:68761094-68761116 CCCTGGTGATCCTAAGAAACAGG + Intronic
1010835066 6:80576033-80576055 CCAAGTAGCTCCCAAGTAGCTGG - Intergenic
1012228301 6:96730591-96730613 CGCAGTAGATGCTAAGAACATGG + Intergenic
1018727270 6:166623334-166623356 GCCAGTAGAGCCTCAGAAGATGG - Intronic
1021061433 7:16117588-16117610 CCCAGTACATCATCAGAACCAGG + Intronic
1021403414 7:20236677-20236699 CCCAGTAGTTTCTTAGGAGCAGG + Intergenic
1025862840 7:65348237-65348259 CCCAGTAGTCCTTCAGAAGCAGG + Intergenic
1027510029 7:79068847-79068869 CCCAGTAGTTATTCAGAAGCAGG + Intronic
1028636263 7:92993017-92993039 CCCAGTGGATCTCAAGAAACTGG - Intergenic
1035591032 8:813738-813760 CCGAGTAGAACCAAAGAATCTGG + Intergenic
1039912015 8:41833461-41833483 TCCAGCAGATGCTAAGCAGCTGG + Intronic
1044048188 8:87464397-87464419 CCCAGTAGTCACTCAGAAGCAGG + Intronic
1048370193 8:133770393-133770415 CCCAGGAGATCCTGAGAACGTGG - Intergenic
1049236308 8:141514108-141514130 TCCAGTAGTCCCTATGAAGCAGG - Intergenic
1050609652 9:7338274-7338296 CCCAGTTGTTCCTAAGTGGCTGG + Intergenic
1051368772 9:16340529-16340551 ACCAGTACACCCTGAGAAGCAGG - Intergenic
1052075450 9:24135217-24135239 CCCAGTACATCCTCCGCAGCCGG - Intergenic
1057384575 9:94595722-94595744 ACCAGTAGATCTTAATATGCAGG + Intergenic
1185765538 X:2723208-2723230 CCCCGTAGAGTGTAAGAAGCAGG + Intronic
1186176308 X:6929272-6929294 CTCAGTAGATCCTGAGAACAAGG + Intergenic
1186407573 X:9317362-9317384 CCCAGCAGTGCCAAAGAAGCTGG + Intergenic
1188952157 X:36389760-36389782 CCTAGTAGACCCTCGGAAGCAGG + Intergenic
1189153610 X:38732642-38732664 CACAATAGATCCTAATAAGGAGG - Intergenic
1190096515 X:47485479-47485501 CCCAGGAGAAGCTGAGAAGCAGG + Intergenic
1193768268 X:85558667-85558689 CCCAGGAGTTACTCAGAAGCAGG + Intergenic
1196905185 X:120424285-120424307 CCGAGTAGCTCCCAAGTAGCTGG - Intergenic
1197927967 X:131666700-131666722 CCCAGTAGTCACTGAGAAGCAGG - Intergenic
1199082700 X:143594268-143594290 CCCAGTAGATCCAATGGTGCTGG - Intergenic
1200737626 Y:6816734-6816756 CCCAGTAGTTACTCAGGAGCAGG - Intergenic
1201050482 Y:9928240-9928262 CCCAGTAGACCTTCAGCAGCAGG - Intergenic
1201419233 Y:13780107-13780129 CCCAGTAGTTACTCAGGAGCAGG + Intergenic