ID: 967770386

View in Genome Browser
Species Human (GRCh38)
Location 3:193328069-193328091
Sequence CTGTTAACTCAGTTGTGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 511}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967770386_967770394 24 Left 967770386 3:193328069-193328091 CCATTTCACAACTGAGTTAACAG 0: 1
1: 0
2: 2
3: 47
4: 511
Right 967770394 3:193328116-193328138 TGAGGAGCCTAATGTCATAGTGG 0: 1
1: 0
2: 0
3: 6
4: 84
967770386_967770392 -4 Left 967770386 3:193328069-193328091 CCATTTCACAACTGAGTTAACAG 0: 1
1: 0
2: 2
3: 47
4: 511
Right 967770392 3:193328088-193328110 ACAGGGTGGAGGCAGGTTAGAGG 0: 1
1: 0
2: 2
3: 44
4: 660
967770386_967770393 6 Left 967770386 3:193328069-193328091 CCATTTCACAACTGAGTTAACAG 0: 1
1: 0
2: 2
3: 47
4: 511
Right 967770393 3:193328098-193328120 GGCAGGTTAGAGGTGAAATGAGG 0: 1
1: 0
2: 5
3: 56
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967770386 Original CRISPR CTGTTAACTCAGTTGTGAAA TGG (reversed) Intronic
900279341 1:1855953-1855975 CTGAGAACACAGTGGTGAAAAGG - Intronic
900876169 1:5343980-5344002 CTGTTTTCTCATCTGTGAAATGG + Intergenic
900961121 1:5921013-5921035 CTGTTTCCTCAGCTGTAAAATGG - Intronic
901250881 1:7778819-7778841 CTGTTTCCTCATTTGTAAAATGG + Intronic
901669796 1:10849575-10849597 CTGTTTCCTCACTGGTGAAATGG + Intergenic
901879081 1:12183350-12183372 CTGTTATCTCATCTGTGAAATGG + Intronic
903021488 1:20398438-20398460 CTGGTACCTCATTTGTGAAATGG - Intergenic
903821315 1:26104590-26104612 TTGTTTCCTCAGTTGTAAAAGGG + Intergenic
904131556 1:28279411-28279433 CTGTTTACTCACCTGTAAAATGG + Intronic
904201985 1:28825874-28825896 CTGTTTTCTCATCTGTGAAATGG + Intronic
904350337 1:29901123-29901145 CAGTTTCCTCAGTTGTGAAATGG + Intergenic
904416378 1:30363457-30363479 CTGTTTCCTCATTTGTAAAATGG + Intergenic
904842196 1:33379617-33379639 CTGAGAAATCAGTGGTGAAAGGG - Intronic
906070288 1:43011373-43011395 CTGTTTCCTCATTTGTGAGATGG + Intergenic
906148271 1:43572782-43572804 CCCTTAACTCAGCTGTGAAGGGG - Intronic
906644914 1:47467740-47467762 CTATTAATTCAGCTGGGAAAGGG - Intergenic
906933774 1:50194320-50194342 CTGTTTCCTCAAGTGTGAAATGG - Intronic
907511573 1:54965249-54965271 CTGTTTACTCATCTGTGAAGTGG + Intergenic
907527218 1:55060884-55060906 CTGTTTACTCATTTGTAAGATGG - Intronic
907789065 1:57643918-57643940 CAGTTTTCTCAGTTGTGAAATGG - Intronic
907819143 1:57949945-57949967 CTGTAACCTCATCTGTGAAATGG - Intronic
908111529 1:60903425-60903447 CTGTTTACTTATCTGTGAAATGG - Intronic
908894503 1:68883167-68883189 CTGTTAACTGAGATGGGGAATGG + Intergenic
908902271 1:68969377-68969399 CTGTTTCCTCATTTCTGAAATGG - Intergenic
909351445 1:74658077-74658099 CTGTTAACTCATCTTTGAAGAGG - Intronic
909547319 1:76862157-76862179 CAGTTCACTCATTTGTGAAATGG + Intergenic
909574899 1:77162979-77163001 CAGTTCACTCACTTGTAAAAAGG + Intronic
909907565 1:81217793-81217815 CTGTCTTCTCAGTTGTAAAATGG - Intergenic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
909981986 1:82114020-82114042 CTGTTTCCTCAATTGAGAAAAGG + Intergenic
909997592 1:82299494-82299516 CTGTTTTCTCATTTGTAAAATGG + Intergenic
911039992 1:93583766-93583788 CAGTTTCCTCAGCTGTGAAATGG + Intronic
912143825 1:106766564-106766586 CTGTGAACTCAGATGTGACTAGG + Intergenic
912549827 1:110478200-110478222 CTGTTTGCTCACCTGTGAAATGG - Intergenic
912993077 1:114508881-114508903 CAGTTTTCTCATTTGTGAAATGG - Intronic
915521171 1:156445140-156445162 CTGTTTCCTCACCTGTGAAATGG - Intergenic
916126633 1:161577262-161577284 CTGTTGTCTCATCTGTGAAATGG - Intergenic
916136552 1:161659102-161659124 CTGTTGTCTCATCTGTGAAATGG - Intronic
916162155 1:161928117-161928139 CAGTTATCTCAGCTGTAAAATGG - Intronic
916211874 1:162366358-162366380 CTGTTACCTCATCTGTAAAATGG - Intronic
916282668 1:163069473-163069495 CTGTTAAATAAGATGTGCAAAGG + Exonic
917230562 1:172832837-172832859 CTGTTTCCTCATCTGTGAAATGG + Intergenic
918197489 1:182235780-182235802 CTGCTTCCTCATTTGTGAAATGG - Intergenic
918301703 1:183210099-183210121 CTGCTACATCATTTGTGAAATGG - Intronic
919179812 1:194066220-194066242 CTGTAGACACAGTAGTGAAATGG - Intergenic
920042572 1:203111900-203111922 CAGTTTTCTCATTTGTGAAATGG + Intronic
920547626 1:206831705-206831727 CTGTTTACTCATCTGTAAAATGG - Intronic
920930446 1:210382988-210383010 CAGTTAACTCATTTGTAACACGG + Intronic
921463522 1:215457763-215457785 CTGTTTCCTCACTTGTGAACAGG + Intergenic
921598340 1:217079640-217079662 CTGTTTCCTCATCTGTGAAATGG + Intronic
921679906 1:218019309-218019331 CTGTTAAGCCAGTTATCAAAAGG - Intergenic
922356953 1:224785556-224785578 CTGTTTTCTCATCTGTGAAATGG + Intergenic
922506929 1:226131924-226131946 CTGTTTCCTCATCTGTGAAATGG - Intergenic
924178532 1:241418099-241418121 CAGTTATCTCCTTTGTGAAACGG + Intergenic
1063874145 10:10454773-10454795 CTGTTAACTCACTGGAGGAAAGG + Intergenic
1064219239 10:13425570-13425592 CAGTTACCTCATCTGTGAAATGG - Intergenic
1065042387 10:21710801-21710823 CTGTTTGCTCATATGTGAAATGG + Intronic
1067061540 10:43080442-43080464 CTGTTTCCTCACCTGTGAAATGG - Intronic
1068261635 10:54590897-54590919 CTGTTACCTCATTTGGGAAGGGG + Intronic
1069083235 10:64110649-64110671 CTGTTCTCTCTGTTGTAAAATGG + Intergenic
1069085943 10:64139654-64139676 CAGTAAACTCATTTGTAAAATGG + Intergenic
1069989900 10:72308822-72308844 CAGTTAACACAGTAGCGAAAGGG - Intergenic
1070713177 10:78698261-78698283 CTGTTTCCTCATTTGTTAAAGGG - Intergenic
1071185410 10:83038145-83038167 CTGTTCACTCAAATGAGAAAAGG - Intergenic
1072323493 10:94273731-94273753 CTGTTAAACCAGTTATGAAAAGG + Intronic
1072869068 10:99097528-99097550 CTGTTAACTAAATTTTTAAAAGG + Intronic
1072880253 10:99219673-99219695 CTGTTTTCTCAGTTATAAAATGG + Intronic
1073146877 10:101286838-101286860 CTGTTTCCTCAGCTGTAAAATGG - Intergenic
1073554339 10:104434108-104434130 CTGTTTCCTCTGCTGTGAAATGG + Intronic
1073718208 10:106133825-106133847 ATGGTAACTCAATTTTGAAATGG - Intergenic
1073969589 10:109032134-109032156 CTGGGAAATCAGTTGTGAAATGG - Intergenic
1074754756 10:116616042-116616064 CTGTTGTCTCAGCTGTAAAATGG + Intergenic
1074864764 10:117538269-117538291 CGGTTGACTCATCTGTGAAAAGG - Intergenic
1075647583 10:124106724-124106746 CTGTTTACCCATCTGTGAAATGG + Intergenic
1075991753 10:126844142-126844164 CAGTTACCTCATCTGTGAAATGG + Intergenic
1076364418 10:129912634-129912656 CTGTGAAATCAGTTGGGAACAGG - Intronic
1076453052 10:130570160-130570182 CAGTTCACTCTGGTGTGAAAAGG - Intergenic
1078945322 11:16060413-16060435 CAGTTTACTCAGCTTTGAAAAGG - Intronic
1079405838 11:20144891-20144913 CTGTTTACTCATCTGTAAAATGG + Intergenic
1080406096 11:31980662-31980684 AGGTTTACTCAGTTTTGAAAGGG + Intronic
1080561134 11:33464088-33464110 CTGTTTCCTCACTTGTGAAAAGG - Intergenic
1080748721 11:35132569-35132591 CTGTTTACTCTTTTGTAAAATGG + Intergenic
1080931109 11:36812120-36812142 CTGTTTCCTCAGTTGTAAAATGG - Intergenic
1081121024 11:39266453-39266475 CAGTTTCCTCACTTGTGAAATGG - Intergenic
1081232305 11:40600313-40600335 CAGTTAACTCTTTTGTTAAAGGG - Intronic
1081280636 11:41205487-41205509 TTGTTAACTCATTTCTAAAAGGG - Intronic
1081725883 11:45328798-45328820 CAGTTTTCTCAGCTGTGAAATGG - Intergenic
1081961867 11:47143827-47143849 CTGTTTCCTCACTTGTAAAATGG + Intronic
1082765519 11:57164473-57164495 CTGTTTTCTCATCTGTGAAATGG + Intergenic
1083171455 11:60925864-60925886 CTGTTTCCTCACTTGTAAAAGGG - Intronic
1084120364 11:67065682-67065704 CTTTGTTCTCAGTTGTGAAATGG - Intronic
1084761317 11:71273039-71273061 CTGTTTTCTCATTTTTGAAATGG + Intergenic
1084869262 11:72085587-72085609 TTGTTTACTCATCTGTGAAATGG - Intronic
1085024879 11:73230558-73230580 CTGTTTCCTCAGCTGTAAAATGG - Intronic
1085157268 11:74307257-74307279 CTGTTTATTCAGTTGTGGAGGGG - Intronic
1085378221 11:76087742-76087764 CTCTTTACTCAGTTCTAAAATGG - Intronic
1085878314 11:80435386-80435408 CAGTTTACTCAGTTGTAAATGGG + Intergenic
1086937465 11:92760630-92760652 CTGTTTTCTCAATTGTGAAATGG + Intronic
1088496220 11:110433835-110433857 CAGTTGCCTCATTTGTGAAATGG + Intronic
1088909681 11:114181332-114181354 CTGTTGCCTCAGCTGTAAAATGG - Intronic
1089184361 11:116604772-116604794 CTGTTTTCTCACTTGAGAAATGG + Intergenic
1089305094 11:117521576-117521598 CAGTTTACTCATTTGTGAAATGG + Intronic
1089386397 11:118070965-118070987 CAGTTTACTCCCTTGTGAAATGG + Intergenic
1089631130 11:119784926-119784948 CTGTTATCTCATCTGTAAAATGG + Intergenic
1090058106 11:123440603-123440625 ATGTTAACTCAGTTATTAGAGGG + Intergenic
1090267459 11:125362286-125362308 CTGTTTTCTCATCTGTGAAATGG + Intronic
1090445807 11:126763708-126763730 TTGTTTTCTCACTTGTGAAATGG + Intronic
1091660228 12:2377703-2377725 CACTTTACTCAGCTGTGAAACGG - Intronic
1093843144 12:23930691-23930713 CAGTTTACTCATTTGTGAAGAGG - Intronic
1094602562 12:31922644-31922666 CTTTGTACTCAATTGTGAAATGG - Intergenic
1094808101 12:34109878-34109900 CTGTTAATTAAGTAGTGAATAGG - Intergenic
1095121841 12:38428328-38428350 CTGTCATCTCAGTTGTAAAATGG + Intergenic
1095508846 12:42927539-42927561 CTGCTAAGTCATTTGTGAACTGG - Intergenic
1095919948 12:47518848-47518870 CTGTAAACTCAGTAGGTAAATGG + Intergenic
1096355324 12:50936477-50936499 CTGTTTTCTCATTTGTCAAATGG - Intergenic
1096464075 12:51838593-51838615 CTGTTTCCTCCATTGTGAAATGG + Intergenic
1096814338 12:54192206-54192228 CAGTTATCTCAGTTGTAAAATGG + Intergenic
1098084790 12:66830700-66830722 CTGTTTTCTCATTTGTAAAATGG - Intergenic
1098174712 12:67778728-67778750 CTGTTAACTCAGGTGTCCATGGG + Intergenic
1098704389 12:73668849-73668871 CTGTTTACTCATTTGTAAAATGG + Intergenic
1100000423 12:89828024-89828046 CAGTTTTCTCATTTGTGAAATGG + Intergenic
1100222952 12:92525764-92525786 CTGTTTACTCATTTCTAAAATGG - Intergenic
1101238111 12:102810653-102810675 CTGTTTCCTCATTTGTAAAATGG + Intergenic
1101555181 12:105802179-105802201 CAGTTTTCTCACTTGTGAAAGGG - Intergenic
1101585538 12:106082450-106082472 CTGTTTCCTCAGCTGTAAAACGG - Intronic
1101619758 12:106374005-106374027 CTTTTAAATCAGTTGGGGAAGGG - Intronic
1102013275 12:109631974-109631996 CTGTTTTCTCATCTGTGAAATGG + Intergenic
1102550689 12:113689714-113689736 CTGTTTTCTCATCTGTGAAATGG - Intergenic
1102789482 12:115632835-115632857 CCGTTTTCTCAGCTGTGAAATGG - Intergenic
1103214161 12:119188757-119188779 CTGTTTCCTCATCTGTGAAAGGG + Intronic
1103810300 12:123608198-123608220 CAGGTAACTCACTTGTAAAATGG - Intronic
1103982396 12:124745087-124745109 CAGTTTACTCAGCTGTAAAATGG - Intergenic
1104149909 12:126072302-126072324 CAGTTACCTCATCTGTGAAATGG + Intergenic
1104296764 12:127522863-127522885 CTGTTTACTCAACTGTAAAATGG - Intergenic
1105335205 13:19460678-19460700 TTGTTAGCTCAGTTCTGAACAGG - Intronic
1105535130 13:21258989-21259011 CTGTTTTCTCATTTGTAAAATGG - Intergenic
1105820740 13:24078768-24078790 CTGTTATCCCAGTTGTGTGATGG + Intronic
1106069889 13:26399760-26399782 TTGTTACCTCATTTGTCAAATGG - Intronic
1106285509 13:28315115-28315137 CTGTTTTCTCATCTGTGAAATGG + Intronic
1106567046 13:30895326-30895348 CAGTTTCCTCATTTGTGAAATGG - Intergenic
1106569353 13:30913029-30913051 CTGTTCACTCATCTGTGGAAAGG - Intronic
1106605026 13:31221147-31221169 CTGTTATCTCATTTGCAAAAGGG + Intronic
1107522332 13:41195348-41195370 CTGTTAATTGATTTGTGGAACGG - Intergenic
1107855180 13:44608164-44608186 CATTTACCTCAGCTGTGAAATGG + Intergenic
1107974701 13:45678104-45678126 ATTTTAACTCAATTCTGAAAAGG - Intergenic
1108123525 13:47215562-47215584 CTGTTACATCATTGGTGAAATGG + Intergenic
1108225831 13:48287752-48287774 CAGTTACTTCAGTTGTAAAAAGG + Intergenic
1108311110 13:49191933-49191955 CCGTTTCCTTAGTTGTGAAATGG - Intronic
1108609254 13:52068136-52068158 CTTTGTACTCAGCTGTGAAATGG + Intronic
1108714182 13:53062546-53062568 CTATTTCCTCAGTTGTAAAATGG + Intergenic
1108807489 13:54176913-54176935 CTGTTTTCTCAGTTGTCAAATGG + Intergenic
1110174994 13:72545682-72545704 CGGTTTCCTCAGCTGTGAAATGG + Intergenic
1110914560 13:81005673-81005695 CTGTGAACTCATTTTTGACAAGG - Intergenic
1111187805 13:84763034-84763056 TTATTTACTCAGCTGTGAAATGG + Intergenic
1112189989 13:97167026-97167048 CTGGTAACAAAGTTGAGAAAAGG + Intergenic
1114005185 14:18305057-18305079 CTGCTTGCTCAGTTGTAAAATGG - Intergenic
1115261427 14:31457925-31457947 CTGATTCCACAGTTGTGAAAAGG + Intergenic
1116976242 14:51119334-51119356 CTGTTTCCTCATTTGGGAAATGG + Intergenic
1117077548 14:52119331-52119353 TTGTTAGCTATGTTGTGAAATGG + Intergenic
1117348521 14:54858182-54858204 GATTTAACACAGTTGTGAAATGG - Intronic
1118859692 14:69653037-69653059 CTGTTTCCTCATTTGTAAAATGG - Intronic
1119140031 14:72258676-72258698 CTGTTTATTCATTTGTCAAATGG + Intronic
1121235568 14:92389334-92389356 CAGTTTACTCACCTGTGAAATGG - Intronic
1121724114 14:96133708-96133730 CTGTTTCCTCATTTGTAAAATGG + Intergenic
1122287921 14:100663358-100663380 CTGTTTCCTCATCTGTGAAATGG - Intergenic
1123010463 14:105347216-105347238 CTGTCAACCCATTTGTAAAATGG - Intronic
1202838752 14_GL000009v2_random:100767-100789 CAGTTAATTCTTTTGTGAAAGGG + Intergenic
1202908112 14_GL000194v1_random:90838-90860 CAGTTAATTCTTTTGTGAAAGGG + Intergenic
1123389641 15:19857291-19857313 CTGTTTGCTTAGTTGTAAAATGG - Intergenic
1124059613 15:26277784-26277806 TTGTTAACTCAGTTTTAAATAGG + Intergenic
1124533201 15:30523639-30523661 CTGTTTCCTCAGCTGAGAAATGG - Intergenic
1125588842 15:40842273-40842295 CTGTTTGCTCATTTGTAAAATGG + Intergenic
1126012316 15:44314830-44314852 CAGTTTCCTCATTTGTGAAATGG + Intronic
1126944843 15:53808185-53808207 CAGTTTACTCACCTGTGAAATGG + Intergenic
1128435205 15:67640476-67640498 CAGTGACCTCAGCTGTGAAACGG + Intronic
1128564246 15:68689434-68689456 CTGTTTTCTTAGTTGTAAAATGG + Intronic
1128691454 15:69727442-69727464 CTGTTTTCTCACCTGTGAAATGG + Intergenic
1129107780 15:73321134-73321156 CTGTCACCTCATTTGTAAAATGG - Exonic
1129229730 15:74190523-74190545 CTGTTAGCTCATCTGTAAAAAGG - Intronic
1129281887 15:74491879-74491901 CTCTCAGCCCAGTTGTGAAATGG - Intergenic
1129852065 15:78799007-78799029 CTGTTTCCTCATCTGTGAAATGG + Intronic
1130097204 15:80864596-80864618 CTGTCCGCTCAGTTGTAAAATGG - Intronic
1130250938 15:82300080-82300102 CTGTTTCCTCATCTGTGAAATGG - Intergenic
1130867388 15:87944472-87944494 CTGTTTTCTCACCTGTGAAAGGG - Intronic
1130901856 15:88213220-88213242 CTGTTTCCTCATGTGTGAAACGG - Intronic
1130927279 15:88395283-88395305 TTATTAGGTCAGTTGTGAAACGG + Intergenic
1131119455 15:89813766-89813788 CAGTTAATTCACCTGTGAAAGGG - Intronic
1131467885 15:92670052-92670074 CTGTTTCCTCATTTGTAAAATGG + Intronic
1131640619 15:94288673-94288695 ATGTTAACTCACATGGGAAAAGG + Intronic
1132106810 15:99068775-99068797 CTGTTTCCTCACATGTGAAATGG + Intergenic
1133851244 16:9505830-9505852 CTGATAACTCAGTTTTCAAATGG + Intergenic
1134068651 16:11246777-11246799 CAGTTTCCTCACTTGTGAAATGG - Intergenic
1134080289 16:11320064-11320086 CAGTTTACCCACTTGTGAAAGGG + Intronic
1134328394 16:13228095-13228117 CTGTTTCCTTAGGTGTGAAATGG - Intronic
1134803993 16:17109168-17109190 CAGTTTTCTCAGCTGTGAAATGG - Intronic
1134863425 16:17582469-17582491 CTGTGAACACAGTGGGGAAAAGG + Intergenic
1135349510 16:21716746-21716768 CTGTTTCCTCACCTGTGAAATGG + Intronic
1136555266 16:31003891-31003913 CTGTTCCCTCATCTGTGAAATGG - Intronic
1138576376 16:57909891-57909913 CTGCTACCTCAGCTGTAAAATGG + Intronic
1138891892 16:61153642-61153664 CAGTTTTCTCATTTGTGAAATGG + Intergenic
1139141762 16:64272664-64272686 TTGTTCTCTCAGTTGTGAATGGG - Intergenic
1139676665 16:68528654-68528676 CTGTTACCCCAGGTGTCAAATGG + Intergenic
1139694486 16:68664023-68664045 CTGTTTCCTCAGCTATGAAATGG - Intronic
1139754157 16:69129590-69129612 CTGTTTCCTCATTTGTGAAATGG - Intronic
1139767730 16:69245890-69245912 CTGTTAACTCAGTTATACAGAGG + Intronic
1139883980 16:70195916-70195938 CTGTTTACTCATCTGAGAAACGG + Intergenic
1140181652 16:72725671-72725693 CAGTTTCCTCATTTGTGAAATGG + Intergenic
1140368536 16:74399580-74399602 CTGTTTACTCATCTGAGAAACGG - Intergenic
1140634844 16:76899953-76899975 CTGTTAACTCACTTGTAGAAAGG + Intergenic
1141195141 16:81854775-81854797 CAGTTTGCTCAGCTGTGAAATGG + Intronic
1142397933 16:89843275-89843297 CTGTTTCCTCATCTGTGAAACGG + Intronic
1142473140 17:174307-174329 CAGTTTACTCATCTGTGAAATGG + Intronic
1143881366 17:10032530-10032552 CTGTTTCCTCATCTGTGAAATGG + Intronic
1144718553 17:17451435-17451457 CTGTTCCCTCAGCTGTGAGATGG - Intergenic
1144877509 17:18409125-18409147 CTGGAAACACAGTTGTGAAAAGG - Intergenic
1145154717 17:20535277-20535299 CTGGAAACACAGCTGTGAAAAGG + Intergenic
1145785768 17:27592940-27592962 CTGTTTTCTCACCTGTGAAATGG - Intronic
1146397763 17:32482472-32482494 CTGTTATCTCATTTGTGTAATGG + Exonic
1146473528 17:33143571-33143593 GAGTTAACTCAGTTGTTAACTGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146818017 17:35960244-35960266 CTGTTTCCTCATTTGTAAAATGG + Intergenic
1147110989 17:38261327-38261349 CTGTTTCCTCAAATGTGAAATGG - Intergenic
1147413539 17:40271701-40271723 CAGTTTTCTCATTTGTGAAATGG + Intronic
1147865485 17:43549276-43549298 CTGTTTCCTCATTTGTAAAATGG - Intronic
1147906823 17:43828898-43828920 CTGTTTCCTCACTTGTAAAATGG - Intronic
1148418521 17:47527113-47527135 CTGTTTCCTCAAATGTGAAATGG + Intronic
1148738275 17:49877234-49877256 CTGTTTTCTCATCTGTGAAACGG + Intergenic
1148840399 17:50492372-50492394 CTGTTTCCTCATTTGTAAAATGG - Intergenic
1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG + Intergenic
1151906361 17:77052044-77052066 CTGTTTCCTCAGCTGTAAAATGG + Intergenic
1151922012 17:77164097-77164119 CTGTTTCCTCAGTTGTAAAGTGG - Intronic
1151935026 17:77256294-77256316 CTGTTTCCTCATCTGTGAAATGG + Intergenic
1153223667 18:2882131-2882153 CTGTTTTCTCACTTGTGAAAAGG + Intronic
1153256763 18:3179502-3179524 CAGTTCCCTCAGATGTGAAATGG + Intronic
1154214497 18:12406349-12406371 CAGTTAACTCATTTGTAAAACGG + Intergenic
1154532238 18:15358801-15358823 CTGCTTGCTCAGTTGTAAAATGG + Intergenic
1155334873 18:24753273-24753295 CTGGTCCCTCACTTGTGAAATGG - Intergenic
1155729261 18:29131966-29131988 CAATTTACTCAGCTGTGAAATGG + Intergenic
1156024233 18:32633037-32633059 CTGTTTCCCCAGGTGTGAAAAGG - Intergenic
1156112201 18:33742244-33742266 TTGTAAACTCAGTTGTAAAATGG - Intronic
1157952487 18:52055328-52055350 CTGTTAACTAACTTGAAAAAAGG - Intergenic
1157981431 18:52386123-52386145 CTGTTTTCTCACCTGTGAAATGG - Intronic
1158044704 18:53142099-53142121 CTGTTACCTAAGTTGAAAAATGG + Intronic
1158284648 18:55866020-55866042 ATGTTAACTGCGTTGTGGAAGGG - Intergenic
1158592924 18:58792500-58792522 CTGTGTACTCAGCTGTGAAATGG + Intergenic
1158719441 18:59910873-59910895 CTTTTGACTCAGTTTTGAGAAGG + Intergenic
1159027855 18:63202452-63202474 CTGTTAACTCATTCCTAAAATGG + Intronic
1163585123 19:18159744-18159766 CTGTTGACTTATTTTTGAAACGG + Intronic
1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG + Intergenic
1164978999 19:32598626-32598648 CTGTTTCCTCAGGTGTAAAACGG - Intronic
1165213237 19:34251962-34251984 ATGTAAAATCAGTGGTGAAATGG - Intergenic
1166605536 19:44139729-44139751 ATGTAAACACAATTGTGAAAAGG + Intergenic
1167325934 19:48825670-48825692 CTGTTTTCTCACCTGTGAAATGG - Intronic
1168345227 19:55647566-55647588 CTGTTAACTCACCTGCAAAATGG - Intronic
925897756 2:8486641-8486663 CAGTTATCTCATTTGTGAAAAGG - Intergenic
926256576 2:11206835-11206857 CTTTTATCACACTTGTGAAAGGG - Intronic
926371567 2:12184095-12184117 CTATTTACTCATCTGTGAAATGG + Intergenic
926717884 2:15939468-15939490 CAGTTTCCTCAATTGTGAAATGG - Intergenic
926718771 2:15943243-15943265 CTGTTAGCGCAGGGGTGAAAGGG + Intronic
928203691 2:29268849-29268871 CTGTTTCCTCAATTGTAAAATGG + Intronic
928676016 2:33652335-33652357 CAGTTTCCTCAGCTGTGAAAAGG + Intergenic
928925061 2:36569101-36569123 TTGTTTACTCATTTATGAAATGG + Intronic
929886624 2:45884289-45884311 CTGTTGACTCACTTGTTGAAAGG + Intronic
930222200 2:48756014-48756036 CTTTTATTTCATTTGTGAAAGGG + Intronic
930273081 2:49279298-49279320 CAGTTTACTTATTTGTGAAATGG - Intergenic
931679006 2:64727600-64727622 CTGTTTCCTCATTTGTAAAATGG + Intronic
932411833 2:71552128-71552150 CTGTTTCCTCATCTGTGAAATGG - Intronic
932815546 2:74858450-74858472 CTATTTCCTCATTTGTGAAAAGG + Intronic
932836894 2:75046322-75046344 CTCTTAACTCTGTGATGAAATGG - Intergenic
934741809 2:96729379-96729401 CTGTTTACTCACTGGTAAAATGG + Intronic
935278123 2:101493353-101493375 ATGTCCACTCAGTGGTGAAATGG + Intergenic
935928953 2:108102423-108102445 CTGTTTCCTCATTTGTGAAATGG - Intergenic
936258719 2:110938501-110938523 CAGTTTACTCATTTGTAAAATGG - Intronic
936819008 2:116496309-116496331 CTGATAACTCAGATATTAAAAGG + Intergenic
937881063 2:126865207-126865229 CTGTTTCCTCATTTGTAAAATGG - Intergenic
938451036 2:131420574-131420596 GTGTTAAGTCAGTCATGAAATGG + Intergenic
938531338 2:132190032-132190054 CTGCTTGCTCAGTTGTAAAATGG + Intronic
938973519 2:136453819-136453841 CAGTTACCTCATTTGTAAAATGG - Intergenic
938978801 2:136506298-136506320 CAGTTTTCTCAGTTGTAAAATGG - Intergenic
939095571 2:137829850-137829872 CAGTTGTCTCAGCTGTGAAATGG + Intergenic
939281444 2:140070582-140070604 CAGTTGACTCATTTGTAAAATGG + Intergenic
939299704 2:140319789-140319811 CTGTTATCTCAACTGTGATAGGG - Intronic
939869966 2:147515979-147516001 CTGTTTCTTCATTTGTGAAATGG - Intergenic
941078970 2:161038224-161038246 CTGTTTCCTCAGTTGTAAAATGG - Intergenic
942190720 2:173466484-173466506 CTGTTACCTCAGTTGTAAAATGG + Intergenic
942545348 2:177057736-177057758 CAGTTTCCTCATTTGTGAAATGG - Intergenic
943614910 2:190081845-190081867 CTGTTAAGTCAGTTGTGGAATGG - Intronic
945250383 2:207761065-207761087 CAGTTTTCTCATTTGTGAAAAGG - Intronic
945749856 2:213768001-213768023 CTCTTAACTCAGTTTGGCAATGG + Intronic
946389433 2:219406572-219406594 CTGTTTCCTCACCTGTGAAATGG - Intergenic
947055835 2:226102358-226102380 CTGTTCACTGAGTTTTAAAAAGG - Intergenic
947758520 2:232586860-232586882 CTGTTTCTTCATTTGTGAAATGG - Intergenic
948154793 2:235772584-235772606 CAGTTGACCCAGCTGTGAAATGG + Intronic
1168961385 20:1872371-1872393 CTGTTACCTCATCTGTAAAATGG + Intergenic
1169829506 20:9808346-9808368 ATGGTAACTCAGTTGAGGAACGG - Intronic
1169943887 20:10967908-10967930 TTGTTACCTCAATTGTGAAATGG + Intergenic
1170766241 20:19291921-19291943 CTGTGACCTCAGTTGATAAATGG + Intronic
1171274722 20:23846965-23846987 CAGTTAACTCATTTGTACAATGG - Intergenic
1171878275 20:30598223-30598245 CTGTTCACCCAGCTGTGAATGGG - Intergenic
1171973739 20:31580678-31580700 CTGTTTCCTCATTTGTAAAATGG + Intergenic
1171988443 20:31677000-31677022 CAGTTGTCTCATTTGTGAAATGG + Intronic
1172024064 20:31935994-31936016 CTGTTTCCTCATTTGTAAAATGG + Intronic
1172033002 20:31994934-31994956 CTGTTTCCTCAGCTGTGAAATGG - Intronic
1172222154 20:33281413-33281435 CTGTTTCCTCCATTGTGAAATGG - Intronic
1172298335 20:33830004-33830026 CTGTTTCCTCATTTGTAAAATGG - Intronic
1172595838 20:36150633-36150655 CAGTTACTTCAGCTGTGAAAGGG + Intronic
1172883925 20:38218865-38218887 CAGTTTACTCAGTGGTAAAATGG + Intronic
1173625168 20:44467135-44467157 CTGTTTACTCCTTTGTTAAATGG + Intergenic
1173825757 20:46046799-46046821 CAGTTTCCTCAGCTGTGAAATGG + Intronic
1174528374 20:51191570-51191592 CTGTTTCCTCATTTGTCAAATGG + Intergenic
1174815493 20:53683679-53683701 CTGTTTTCTCATCTGTGAAATGG - Intergenic
1174975726 20:55331362-55331384 CTGTTCACTCATCTGTCAAATGG - Intergenic
1175201546 20:57281254-57281276 CTGTTTTCTCATTTGTAAAATGG + Intergenic
1175420899 20:58832720-58832742 CTCTTATCTCAGTTGTGGACAGG + Intergenic
1175481830 20:59317123-59317145 CTGTTTACTGAGTAGTGAACAGG - Intronic
1176627473 21:9105515-9105537 CAGTTAATTCTTTTGTGAAAGGG + Intergenic
1176738372 21:10574308-10574330 GTGTTAGCTCAGTTCTGAACAGG + Intronic
1176765124 21:13009397-13009419 CTGCTTGCTCAGTTGTAAAATGG - Intergenic
1180062406 21:45392472-45392494 CTGTTTCCTCATCTGTGAAAAGG - Intergenic
1180429697 22:15235849-15235871 CTGCTTGCTCAGTTGTAAAATGG - Intergenic
1180879663 22:19194881-19194903 CTGTCAGCTCAGGTGTGAAGGGG - Intronic
1181812318 22:25411136-25411158 ATGTTAACCGAGTTGGGAAAAGG + Intergenic
1182086719 22:27565970-27565992 CAGTTTCCTCAGTTGTAAAATGG + Intergenic
1182446149 22:30390712-30390734 CTGTGTCCTCAGTTGTAAAATGG + Intronic
1182944834 22:34312206-34312228 CTGTTTTCTCATTTGTAAAATGG - Intergenic
1183071100 22:35396863-35396885 CAGTTTCCTCATTTGTGAAAGGG + Intergenic
1183405005 22:37626083-37626105 CAGTTTCCTCAGTTGTGAAGTGG - Intronic
1183457617 22:37931192-37931214 GAGTTTACTCAGCTGTGAAATGG + Intronic
1183723878 22:39577902-39577924 CTGTTTGCTCATCTGTGAAATGG + Intronic
1184249082 22:43250094-43250116 CTGTTTCCTCAGCTGTAAAATGG - Intronic
1184252162 22:43266965-43266987 CTGTTTTCTCGGCTGTGAAATGG + Intronic
1184445205 22:44543030-44543052 CGGTTTACTCATCTGTGAAATGG + Intergenic
949501824 3:4687394-4687416 CTGTTTACTCATCCGTGAAAAGG - Intronic
949934134 3:9103466-9103488 CAGTTTCCTCATTTGTGAAATGG - Intronic
950069377 3:10139962-10139984 CTGTTTCCTTAGCTGTGAAATGG + Intergenic
950121472 3:10484900-10484922 CAGTTTCCTCAGCTGTGAAATGG + Intronic
950129589 3:10532928-10532950 CAGTTTTCTCATTTGTGAAAAGG + Intronic
950131160 3:10547591-10547613 CTGTTTTCTCATCTGTGAAATGG - Intronic
950274194 3:11644444-11644466 CTGTTTCCTCTGCTGTGAAAGGG - Intronic
950560142 3:13716561-13716583 CTGTTTCCTCATCTGTGAAATGG - Intergenic
950612959 3:14137727-14137749 CTGTTTCCTCATTTGTGAAGGGG + Intronic
952868927 3:37880198-37880220 CTGTTTCCTCAGCTGTAAAAGGG - Intronic
955029238 3:55200569-55200591 CTGTTTCCTCATTTGTAAAATGG + Intergenic
955215156 3:56979293-56979315 CAGTTTACTCAGTTGCAAAATGG - Intronic
955317742 3:57952908-57952930 CAGTTACCTCATCTGTGAAATGG + Intergenic
955689552 3:61577933-61577955 CTGTTTACCCATCTGTGAAATGG + Intronic
955715170 3:61821867-61821889 CTGTTTACTCATCTGTAAAATGG - Intronic
956084516 3:65595939-65595961 CTGTTTGCTCAGTTGAGAAATGG + Intronic
956668211 3:71661791-71661813 CTGTTTCCTCATTTGTCAAATGG + Intergenic
957143112 3:76386738-76386760 CTGTTAATTCAGTGTTGAAGTGG + Intronic
960964464 3:123095137-123095159 CTGTTTCCTCAGCTGTGAAATGG + Intronic
962005121 3:131341074-131341096 CTGTTATCTAAGATGTGAGAAGG - Intronic
962057277 3:131885882-131885904 CTATTAATTCAGTTTTAAAAGGG + Intronic
962353267 3:134671864-134671886 CTGTTTTCTCATCTGTGAAATGG + Intronic
963838181 3:150078513-150078535 CAGTTTCCTCAGCTGTGAAATGG - Intergenic
964564090 3:158030637-158030659 CTGTTTCCTCAGTTTTAAAATGG + Intergenic
965046198 3:163581003-163581025 CTCTGATCTCAGTTGTGTAATGG + Intergenic
965258903 3:166454272-166454294 CTGTTTACTTATCTGTGAAAAGG - Intergenic
966932727 3:184686291-184686313 CTGTGGCCTCATTTGTGAAATGG - Intergenic
967143113 3:186580472-186580494 CTGTTACCTCACCTGTAAAATGG + Intronic
967770386 3:193328069-193328091 CTGTTAACTCAGTTGTGAAATGG - Intronic
967991939 3:195138004-195138026 CTGTTTCCTCATCTGTGAAATGG - Intronic
969038139 4:4272742-4272764 CTGTTTACTAAGTTGAGAAGGGG + Intronic
969091374 4:4696315-4696337 CTGTTTCCTCAACTGTGAAATGG + Intergenic
969210287 4:5682023-5682045 CTGTTTTCTCATCTGTGAAATGG + Intronic
969968914 4:11026195-11026217 CAGTTTGCTCATTTGTGAAATGG + Intergenic
970395712 4:15663588-15663610 CTGCTCACTCATCTGTGAAATGG + Intronic
971010396 4:22428276-22428298 CAGTTTACTCATTTGTAAAATGG + Intronic
971208499 4:24593090-24593112 CAGTGAACCCAGTTCTGAAATGG - Intergenic
971253526 4:24993061-24993083 CTGTTGATTCATTTGTAAAATGG + Intergenic
971300082 4:25434681-25434703 CAGTTTACTCAGCTGTGAAATGG - Intergenic
974066993 4:57087791-57087813 CTGTTGTCTCACCTGTGAAATGG - Intronic
975437488 4:74370013-74370035 CTGTTTCCTCATTTGTAAAACGG - Intronic
975545821 4:75559492-75559514 GTGTTCACCCAGTTATGAAATGG + Intronic
975553883 4:75640531-75640553 CTGTTTCCTTATTTGTGAAATGG - Intergenic
975647350 4:76558312-76558334 CAGTTTCCTCATTTGTGAAATGG + Intronic
976003804 4:80403039-80403061 ATATTAAATCAGTTTTGAAAAGG + Intronic
976154289 4:82125818-82125840 CTATTAACTCTGTTGTGTAGCGG + Intergenic
977324106 4:95553416-95553438 CTGTTTCCTCATTTATGAAACGG - Intergenic
978736894 4:112093866-112093888 CAGTTTTCTCATTTGTGAAATGG - Intergenic
978744475 4:112176067-112176089 CTGTTTACTCACTTTGGAAAGGG - Intronic
979621041 4:122799086-122799108 CAGTTTCCTCAGTTGTAAAACGG - Intergenic
980200436 4:129650399-129650421 CTGTTTCCTCATCTGTGAAATGG - Intergenic
981456084 4:144954538-144954560 CTGCTAACCCAGTGGAGAAAAGG - Intergenic
982306272 4:153934480-153934502 CTATTAACTCTGCTGTGAATGGG + Intergenic
982309022 4:153964583-153964605 CTATTCTTTCAGTTGTGAAATGG + Intergenic
982908212 4:161105263-161105285 CTGTTAAATCAGTGTTTAAATGG + Intergenic
983046485 4:162992966-162992988 CTGTTATATCATTTGTGAAATGG + Intergenic
984670775 4:182484429-182484451 CTGTTCTGTCAGCTGTGAAAGGG - Intronic
985769997 5:1803538-1803560 CAGTTTTCTCATTTGTGAAATGG + Intronic
986998079 5:13629973-13629995 CTGTTAACTGAGATATGAATTGG + Intergenic
987785129 5:22489432-22489454 TTGATAACTCAGTTATCAAATGG - Intronic
988943510 5:36170157-36170179 CAGTTTACTCATTTGTGAAATGG - Intronic
990221472 5:53595030-53595052 ATTTTAAATCAGTGGTGAAAAGG - Intronic
990622617 5:57577182-57577204 CTGTTTCTTCAGTTGTAAAATGG + Intergenic
990819216 5:59818275-59818297 CAGTTTGCTCAGTTGTGAAATGG + Intronic
991698900 5:69298941-69298963 CTGTTACCTCATTTGTGAAGTGG + Intronic
991860861 5:71011775-71011797 CCATGAACTCAGCTGTGAAATGG + Intronic
992575271 5:78102494-78102516 TTGTTTACTCATTTGAGAAATGG - Intronic
993483760 5:88456180-88456202 CTGTTTGCACAGTTGTTAAATGG + Intergenic
994252692 5:97555605-97555627 CTGCTACCTCTGTTGGGAAATGG - Intergenic
994416644 5:99480470-99480492 CTGGGAACTCAGTCATGAAAAGG - Intergenic
994422711 5:99541578-99541600 CTGTTTACTCACTTGTTAGAAGG - Intergenic
994459661 5:100055926-100055948 CTGTTTACTCACTTGTTAGAAGG + Intergenic
994913216 5:105940536-105940558 CTGTTCTCTCATTTGTCAAATGG + Intergenic
995413069 5:111880182-111880204 CTGTTTACTCATCTGTAAAATGG + Intronic
996871028 5:128193457-128193479 CTGTTATCTCATCTGAGAAATGG - Intergenic
996920726 5:128764872-128764894 CTGATTACTCACTTCTGAAATGG + Intronic
997690868 5:135826691-135826713 CTGTTTACTCAGCTGTAGAATGG - Intergenic
998070463 5:139193867-139193889 GTGTCACCTCATTTGTGAAATGG - Intronic
998526415 5:142847112-142847134 CTGTTTTCTCATCTGTGAAACGG + Intronic
998764702 5:145472699-145472721 CAGTTTCCTCAGTGGTGAAATGG + Intronic
999006409 5:147985043-147985065 CGGCTAACTCATTTGTAAAATGG - Intergenic
999390791 5:151187982-151188004 CAGTTACCTCAACTGTGAAATGG + Intronic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
999921391 5:156325471-156325493 CTGTTTCCTCATCTGTGAAATGG - Intronic
999953479 5:156675175-156675197 CAGTTCCCTCATTTGTGAAATGG + Intronic
1000253339 5:159515446-159515468 CTGTTTTCTCAGCTGTGAAGTGG - Intergenic
1000385557 5:160671775-160671797 CAATTACCTCACTTGTGAAATGG - Intronic
1000607642 5:163341685-163341707 CTGTTACTTCATCTGTGAAATGG - Intergenic
1001163207 5:169339726-169339748 CAGTTTACTCATTTGTAAAAGGG - Intergenic
1001271329 5:170314379-170314401 CAGTTTTCTCAGCTGTGAAATGG + Intergenic
1001283549 5:170405846-170405868 CTGGTAACACAGCTGTGGAAAGG - Intronic
1001383921 5:171322504-171322526 CTGTCTCCTCAGTTGTGGAAAGG + Intergenic
1001901897 5:175438321-175438343 CTGTTTGCCCATTTGTGAAATGG - Intergenic
1002957947 6:1887042-1887064 CTGTTTTCTCATCTGTGAAATGG - Intronic
1003261449 6:4520109-4520131 CTGTTTTATCACTTGTGAAATGG - Intergenic
1003376086 6:5578929-5578951 CTGTTTTCTCATTTGTAAAATGG + Intronic
1003766603 6:9243993-9244015 CTGTTTCCTCAACTGTGAAATGG + Intergenic
1003812886 6:9804437-9804459 GTGGTACCTCAGTTGTGATATGG + Intronic
1003814914 6:9828836-9828858 CCGTTTTCTCATTTGTGAAATGG - Intronic
1003835865 6:10071932-10071954 CTGAGAACTTGGTTGTGAAAAGG + Intronic
1003941286 6:11029831-11029853 CTTGTAAGTCAGTTGTGAAAGGG - Intronic
1003942058 6:11039184-11039206 CTGTTTACTCACTTGCTAAATGG - Intronic
1004391285 6:15211784-15211806 CCTTTAACTCATTTGTAAAATGG + Intergenic
1004481639 6:16025208-16025230 ATGATATCTCAGTTTTGAAAAGG - Intergenic
1005091703 6:22063447-22063469 CTGTTTACTCACTTGTTTAATGG + Intergenic
1005897198 6:30188537-30188559 CTGCTAACTCAGTTCTGCTATGG + Intronic
1006078372 6:31548951-31548973 CTGTTTCCTCAGCTGGGAAATGG - Intronic
1007238401 6:40407415-40407437 CTGTTTCCTCACATGTGAAATGG + Intronic
1007408393 6:41647706-41647728 CTGTTTTCTCATCTGTGAAATGG + Intronic
1007788527 6:44296057-44296079 CAGTTTCCTCATTTGTGAAATGG - Intronic
1010212783 6:73375258-73375280 CTGTTCTCTCAGCTGGGAAAAGG - Intronic
1010536292 6:77035997-77036019 CTGTTTCCTTATTTGTGAAATGG + Intergenic
1012102089 6:95102888-95102910 TTGTTCTCTCAGTTTTGAAATGG - Intergenic
1014397131 6:120938039-120938061 CAGTTTCCTCATTTGTGAAAGGG + Intergenic
1015859305 6:137658849-137658871 CAGTTTTCTCAGCTGTGAAATGG + Intergenic
1016428621 6:143959673-143959695 CAGTTTCCTCATTTGTGAAATGG - Intronic
1016801170 6:148170586-148170608 ATGATAACACAGTTGTGACAGGG - Intergenic
1017999045 6:159562242-159562264 CTGTTAACTGATTTTTGACAAGG - Intergenic
1018357145 6:163029573-163029595 CTTTCAACTCAGTGGTGGAAAGG + Intronic
1019427329 7:983796-983818 CTGTTTCCTCATCTGTGAAATGG + Intronic
1019557940 7:1641874-1641896 CTGTTTTCTCATCTGTGAAAGGG + Intergenic
1021218504 7:17946415-17946437 CAGTTTACTCATTTGTAAAATGG - Intergenic
1022026864 7:26456222-26456244 CTGTTTCCTCACTTGTAAAATGG - Intergenic
1022182769 7:27938540-27938562 CAGTTACCTCATGTGTGAAATGG + Intronic
1022321006 7:29287461-29287483 CAGTTTACTCATTTGTGAAGTGG + Intronic
1022544297 7:31171316-31171338 CAGTTTTCTCAGGTGTGAAAAGG - Intergenic
1022573620 7:31476642-31476664 CTGTTTTCTCAGCTGTAAAATGG - Intergenic
1023317666 7:38956998-38957020 CTGTTTTCTCACTTGTGAAATGG - Intergenic
1023362968 7:39434388-39434410 CTGTTACCTCATTTGTAAAGTGG + Intronic
1023584416 7:41714613-41714635 CTGTTAACTCATTTTTGAATGGG + Intergenic
1024018314 7:45339729-45339751 CTGTTAACTCAGTTATATGATGG - Intergenic
1024287588 7:47772704-47772726 CAGTTTACTCATCTGTGAAATGG + Intronic
1024551277 7:50564430-50564452 CTGTTTGCTCACTTGTGAAATGG + Intronic
1024567370 7:50692885-50692907 GTGTTAACTCAGTGGTGGGATGG - Intronic
1025254192 7:57372440-57372462 CAGTTTCCTCAGCTGTGAAATGG + Intergenic
1025996405 7:66530114-66530136 CTGTTTGCTCAGTTGCAAAATGG - Intergenic
1026617674 7:71920657-71920679 CAGTTTCCTCAGTTGTAAAATGG + Intronic
1027385102 7:77652258-77652280 TAGTTAACTCAGTTGAAAAAGGG + Intergenic
1027631211 7:80608604-80608626 CTGTTTACTCATTTGTAAAATGG - Intronic
1027644583 7:80781248-80781270 TTGTTATCTTACTTGTGAAAAGG - Intronic
1027753741 7:82184934-82184956 CTGTTTACTCCTTTGTAAAATGG - Intronic
1028190611 7:87846455-87846477 CTGATTACTCAGTTATGAAAAGG - Intronic
1028354857 7:89894459-89894481 CAGCTTACTCAGCTGTGAAATGG - Intergenic
1030706031 7:112694022-112694044 CAGTGAACTCATTTTTGAAAAGG - Intergenic
1030782035 7:113612669-113612691 CTGATAACACAGTTAAGAAATGG - Intergenic
1031346970 7:120679793-120679815 TATTTAATTCAGTTGTGAAATGG - Intronic
1032142917 7:129350256-129350278 TTGTTTCCTCAGTTGTGAAATGG + Intronic
1036140996 8:6208095-6208117 CTGATTACTCAATTGTGAGATGG - Intergenic
1036748452 8:11427295-11427317 CTGGTTTCTCAGTTGTGACATGG + Intronic
1037180286 8:15996696-15996718 TTGTTAACTCAGTAGTCAATAGG + Intergenic
1037862078 8:22412447-22412469 CTGTTTCTTCAGATGTGAAATGG + Intronic
1038163421 8:25061966-25061988 CAGTTAACTCATCTGTAAAATGG - Intergenic
1041550182 8:59091573-59091595 CTGTTACCTCATCTGTAAAATGG + Intronic
1042176404 8:66041085-66041107 GTGTTAACTTACTTGGGAAAGGG - Intronic
1042256691 8:66811604-66811626 CTGTTTAGTCAGTAATGAAATGG + Intronic
1042847125 8:73179555-73179577 CTGTTCACTGAGTTGTATAATGG - Intergenic
1042956565 8:74257426-74257448 CTGTTAATTCTGTTGGGGAATGG - Intronic
1043497236 8:80815736-80815758 CTGTTTACTCATTTGCAAAATGG + Intronic
1043503259 8:80876642-80876664 CTGTTTCCTCATCTGTGAAATGG + Intergenic
1044558868 8:93593035-93593057 CTGTTTGCTCACCTGTGAAATGG - Intergenic
1044593446 8:93936182-93936204 ATGTTGACTGACTTGTGAAATGG - Intergenic
1044910350 8:97051713-97051735 CAGTTTACTCATTTGTAAAATGG - Intronic
1045103441 8:98867745-98867767 CAGTTTTCTCATTTGTGAAATGG + Intronic
1045339534 8:101240748-101240770 CAGTTTCCTCATTTGTGAAATGG + Intergenic
1045517706 8:102875044-102875066 CTGTTTTCTCATTTGTAAAATGG - Intronic
1045630571 8:104116509-104116531 CAGTTAAATCTGTTCTGAAATGG + Intronic
1045642239 8:104263416-104263438 CTGTTAACTCATCTGTAAATTGG + Intergenic
1046971495 8:120228353-120228375 CTGTAGACCAAGTTGTGAAAAGG - Intronic
1047215751 8:122874673-122874695 CTGTTTTCTCAGTGGTAAAATGG - Intronic
1047450991 8:124964909-124964931 CTGTTTACAGAGTTGTGAACAGG + Intergenic
1048356716 8:133659930-133659952 CAGTGAACTCATCTGTGAAATGG + Intergenic
1048690262 8:136955482-136955504 CTGTTAATGCAGTTCTGAAGAGG - Intergenic
1049746700 8:144266136-144266158 GGGTTAACTCAGTTGTGCCACGG + Intronic
1050148927 9:2599690-2599712 CTGGTAACACAGCTGTGCAAAGG + Intergenic
1050746934 9:8887064-8887086 CAGTTAACTCACATGTAAAATGG - Intronic
1050838163 9:10111083-10111105 CTTTTAACTTATTTGTAAAAAGG + Intronic
1053709946 9:40796529-40796551 CTGCTTGCTCAGTTGTAAAATGG + Intergenic
1054419850 9:64917323-64917345 CTGCTTGCTCAGTTGTAAAATGG + Intergenic
1056215837 9:84405125-84405147 CTGTTGCCTCATCTGTGAAATGG - Intergenic
1056292724 9:85160249-85160271 CATCTAACTCAGTGGTGAAAAGG + Intergenic
1056292864 9:85161220-85161242 CATCTAACTCAGTGGTGAAAAGG + Intergenic
1057309288 9:93931736-93931758 CTGTTTCCTCATCTGTGAAATGG + Intergenic
1057414839 9:94851986-94852008 CTGTCATCACAGTTGTCAAACGG - Intronic
1057724255 9:97556978-97557000 CTCCTAACTCAGGTGTGACACGG + Intronic
1058092656 9:100823290-100823312 CTGTTAACTCTGTGGGGGAAAGG + Intergenic
1058580490 9:106451031-106451053 CTGTTACCCCAGTTGCAAAATGG - Intergenic
1058655069 9:107212905-107212927 CAGTTTCCTCAATTGTGAAATGG - Intergenic
1058929796 9:109707897-109707919 CTGTTTCCTCATCTGTGAAATGG - Intronic
1059032158 9:110710300-110710322 CTATTTCCTCATTTGTGAAATGG + Intronic
1059454519 9:114391116-114391138 CTGTTTACCCAACTGTGAAATGG - Intronic
1059755367 9:117288627-117288649 CAGATTTCTCAGTTGTGAAATGG + Intronic
1059758388 9:117315520-117315542 CTGTTTCCTCATTTATGAAATGG + Intronic
1060048269 9:120358408-120358430 CTGTTTCCTCATCTGTGAAATGG - Intergenic
1060797551 9:126522813-126522835 CTGTTTCCTCAGCTGTAAAATGG - Intergenic
1060882249 9:127125459-127125481 CTGTTTCCTCACTTGTAAAAAGG + Intronic
1061486352 9:130922427-130922449 CCGTTTCCTCAGCTGTGAAACGG - Intronic
1062046683 9:134427618-134427640 GGGATTACTCAGTTGTGAAATGG + Intronic
1203750317 Un_GL000218v1:73202-73224 CAGTTAATTCTTTTGTGAAAGGG + Intergenic
1186195466 X:7107056-7107078 TTCTTAAATCAGTTGTGAACAGG - Intronic
1186281444 X:7997488-7997510 GTGTTGACACAGTTGTAAAAAGG - Intergenic
1186462352 X:9758375-9758397 CTGTTTTCTCAGCTGTGAAATGG - Intronic
1187769940 X:22683867-22683889 CAGTTTACTTATTTGTGAAATGG + Intergenic
1188669355 X:32864243-32864265 CTGTTTCATCAGTTGTAAAATGG - Intronic
1189347410 X:40252541-40252563 TTGTTAATTCATTTGTAAAATGG + Intergenic
1189708917 X:43788640-43788662 CTGTTTATTCAGTTGTCGAAAGG + Intronic
1189876096 X:45437762-45437784 CTGTTTCCTCATTTGTAAAATGG - Intergenic
1191963646 X:66731213-66731235 CAGTTTCCTCATTTGTGAAATGG + Intergenic
1192048120 X:67698016-67698038 CAGTTAACTAATTTGTAAAATGG - Intronic
1192101972 X:68274243-68274265 CAGTTACCTCATTTGTGAAATGG + Intronic
1192227504 X:69239144-69239166 CAGTTTGCTCACTTGTGAAATGG - Intergenic
1193535037 X:82704135-82704157 CTGAAAACTCAGTTTTTAAAAGG + Intergenic
1194109947 X:89821267-89821289 CTGGTGAGGCAGTTGTGAAAGGG - Intergenic
1194766666 X:97849543-97849565 CAGTTTACTCATTTGTGATATGG + Intergenic
1194878760 X:99223203-99223225 CTGTTAAGGCAGTTCTGAGAGGG + Intergenic
1195787007 X:108536826-108536848 CTGTTTTCTCATTTGTAAAATGG - Intronic
1196144429 X:112301311-112301333 CAGTTTACTCATTTGTAAAATGG + Intergenic
1196440882 X:115719256-115719278 CTGGTACCTCTTTTGTGAAACGG - Exonic
1196487547 X:116230717-116230739 TTGCTAAATCAGTTTTGAAAGGG + Intergenic
1196764501 X:119230588-119230610 CTGTTTCCTCAGCCGTGAAATGG + Intergenic
1197459092 X:126716914-126716936 CAGTTTACTCATTTGTGAAGTGG + Intergenic
1198156363 X:133964857-133964879 CTGTTAACTCATTTTTCAAATGG - Intronic
1198156376 X:133964976-133964998 CTGTTAACTCATTTTTTAAATGG - Intronic
1198607151 X:138354110-138354132 ATGTTAACACAGTTGTTGAAAGG + Intergenic
1199529956 X:148835201-148835223 CTCTAAAATCAGTGGTGAAAGGG + Intronic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic
1200462612 Y:3476005-3476027 CTGGTGAGGCAGTTGTGAAATGG - Intergenic
1201163968 Y:11190842-11190864 CAGTTAATTCTTTTGTGAAAGGG + Intergenic
1201687233 Y:16718925-16718947 CTGTTACCACAGTTATGACATGG - Intergenic
1202596608 Y:26547449-26547471 GTGTTAGCTCAGTTCTGAACAGG + Intergenic