ID: 967770826

View in Genome Browser
Species Human (GRCh38)
Location 3:193331758-193331780
Sequence CTGGATACTAACTCTGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967770823_967770826 2 Left 967770823 3:193331733-193331755 CCAATATAAAATTAGCTTGCTCT 0: 1
1: 0
2: 0
3: 19
4: 155
Right 967770826 3:193331758-193331780 CTGGATACTAACTCTGGAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967770826 Original CRISPR CTGGATACTAACTCTGGAGC AGG Intronic
901218305 1:7567102-7567124 GTGGATAATAACTCCAGAGCAGG + Intronic
903574594 1:24331250-24331272 ATGGACACAAACTCTGGAGCTGG - Intronic
904263662 1:29305469-29305491 CTGGATAGTAAGCCTGGAGCGGG - Intronic
905259470 1:36707255-36707277 CTGGATGCTAAGTGTGGAGAAGG - Intergenic
905351914 1:37352976-37352998 ATGGGTACCAACTCTGAAGCCGG - Intergenic
906832223 1:49045042-49045064 CAGGAAACTAAACCTGGAGCAGG + Intronic
907712459 1:56896843-56896865 CTGGGTTCTAACTCTGTGGCAGG + Intronic
908210829 1:61898023-61898045 CTAGATACTAAGTCTGTAGAGGG + Intronic
920850849 1:209627059-209627081 CTGGATTCTACCTGTGGACCAGG - Intronic
923878703 1:238079086-238079108 CTGGATAATTAATCTGGAACTGG + Intergenic
1062969359 10:1634168-1634190 CTTGAATCTGACTCTGGAGCGGG - Intronic
1063428914 10:5971644-5971666 CAGGATGCTCACTGTGGAGCTGG + Intronic
1063753697 10:8981820-8981842 CTGGGCACTTACTGTGGAGCAGG - Intergenic
1064154579 10:12893490-12893512 CTGACTACTTACTCAGGAGCTGG + Intergenic
1064652242 10:17521192-17521214 CTGGAAAATAATACTGGAGCAGG - Intergenic
1067809105 10:49413149-49413171 CTGGATTCAAACTCTGGCTCAGG + Intergenic
1070401944 10:76060520-76060542 CTGGCTAGTAATTGTGGAGCTGG + Intronic
1072654212 10:97319339-97319361 CTGAAGACTAAGTCTGGACCGGG - Exonic
1076076382 10:127537171-127537193 CTGGAAGCTGTCTCTGGAGCAGG + Intergenic
1090197525 11:124829485-124829507 CTGGATACCAATTCTGGGACAGG - Intergenic
1090240720 11:125179637-125179659 CTGGAGTCTGACTCTGAAGCAGG + Intronic
1091288865 11:134425641-134425663 CTGATCACTAACTCTGGAGAGGG + Intergenic
1095925062 12:47570138-47570160 CAAGAAACTAACTCAGGAGCTGG - Intergenic
1096553565 12:52389922-52389944 CAGGATCCTATCTGTGGAGCAGG + Intergenic
1098367354 12:69718824-69718846 CTGGATGCTGACTCTGGAGTGGG + Intergenic
1101050011 12:100852318-100852340 CTGGATTCAACCTCTGCAGCAGG - Intronic
1102470530 12:113157551-113157573 CTGGACAGTGACTCTGGGGCTGG + Exonic
1102872735 12:116426678-116426700 CTGGATCCCAACTCTGCAGGCGG + Intergenic
1103023083 12:117552211-117552233 CTGGATATTAACTATGGGCCAGG + Intronic
1105676612 13:22679036-22679058 CTTGATACTGATTCTGGAGTGGG - Intergenic
1106273863 13:28183966-28183988 CTGGCTACTCACTCTGTATCAGG + Intronic
1107308059 13:39044343-39044365 CTGGGTAATTACTCTGGGGCTGG + Intronic
1113454272 13:110437102-110437124 CTGGTTCCCAACTCTTGAGCAGG + Intronic
1117273071 14:54164682-54164704 CTGGAGAATAACTCTGAGGCTGG - Intergenic
1119210210 14:72825800-72825822 GTGGATACTAAGTAAGGAGCTGG + Intronic
1119761742 14:77156578-77156600 CTGCAGACCAACTCTGGAGGAGG - Intronic
1120647148 14:87087506-87087528 CTGGAGTTTTACTCTGGAGCAGG + Intergenic
1132252798 15:100346881-100346903 CTGGATACATGGTCTGGAGCTGG - Intergenic
1137592683 16:49703459-49703481 CTGGAAATTTACTCTGGATCTGG + Intronic
1137706525 16:50539442-50539464 CTGGATTCTAACTCTCTTGCAGG - Intergenic
1139551826 16:67677725-67677747 CTGGATACCAAGTCTTGGGCTGG + Intronic
1141858673 16:86701807-86701829 CCGGATACTCACTCTGGAGGAGG - Intergenic
1142316674 16:89351536-89351558 CTGGATACAGACTCTCGGGCAGG + Intronic
1143504610 17:7356724-7356746 CTGGAGACTGTCTTTGGAGCTGG - Exonic
1146476354 17:33165686-33165708 CTTGTTACTATCTCTGGAACTGG - Intronic
1147849066 17:43427235-43427257 TTGGATACTCACACTGGGGCAGG - Intergenic
1148692469 17:49538527-49538549 CTGGATAGGAACTGTGCAGCTGG - Intergenic
1150264564 17:63823985-63824007 ATGGATAGAAACTTTGGAGCTGG - Intronic
1153174035 18:2350837-2350859 CTGGAGACTAGCGCTGGAGAGGG + Intergenic
1153199974 18:2637987-2638009 CTGCATTCTAACTCTAGAACCGG + Intergenic
1154218460 18:12432501-12432523 CTGGAAACCATCTCTGAAGCAGG + Intergenic
1155682284 18:28503022-28503044 CTTGATAATAACTCTGGAGTGGG + Intergenic
1156388308 18:36626510-36626532 CTGGACCCAGACTCTGGAGCAGG - Intronic
1156503220 18:37572898-37572920 CTGGTCACTCACTCGGGAGCTGG + Intergenic
1157956688 18:52106217-52106239 CTGGATACAAATTCTTGATCAGG - Intergenic
1161452296 19:4353154-4353176 CTGGGCCCTAAGTCTGGAGCCGG + Intronic
1164763032 19:30742609-30742631 CTGGATCCTTTCTGTGGAGCCGG + Intergenic
1167249693 19:48393412-48393434 CTGGAGTCTAGCTCTGAAGCTGG + Intergenic
1168234066 19:55050894-55050916 ATGAATACCAGCTCTGGAGCAGG + Intronic
927489310 2:23510323-23510345 CTGGATACTAAATGAGGAGGTGG - Intronic
928021017 2:27704945-27704967 ATGGACTCTAACTCTGGAGAAGG - Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
930734485 2:54762517-54762539 ACGGATACTAAATCTGGAGGTGG - Intronic
931420027 2:62118562-62118584 CTGAAGACTAACTCAGGATCTGG - Intronic
944661281 2:201923830-201923852 CTGGATACTGGCACAGGAGCAGG + Intergenic
947017571 2:225638502-225638524 CTGGAGAGGAACTCTGGAGGTGG + Intronic
947195702 2:227565028-227565050 CTGCATACCTACTCTTGAGCTGG - Intergenic
948157571 2:235796098-235796120 CTGAATAGTAACTCTGAAGCTGG + Intronic
1170373161 20:15671601-15671623 CAGGATACTAAAGCTGGAGGGGG - Intronic
1170734062 20:18998500-18998522 CTGGATAAGATCTCAGGAGCTGG + Intergenic
1171467453 20:25339988-25340010 CAAGATAAGAACTCTGGAGCTGG - Intronic
1174279362 20:49427644-49427666 CTGGATATTAAGTCTGGTTCAGG + Intronic
1178600278 21:33988588-33988610 CTGGATTCTAACTCAGGAGCTGG - Intergenic
1184336523 22:43856394-43856416 CTGGATGGTAACTCTTGTGCAGG - Intronic
1185187994 22:49414418-49414440 CCTGCTACTAACACTGGAGCAGG - Intergenic
950251699 3:11470921-11470943 CTGGAGAATAATTCTGGAGAAGG - Intronic
950273532 3:11639265-11639287 CTGGGGACTGGCTCTGGAGCTGG + Intronic
955898587 3:63727143-63727165 CTGGAGAAGAGCTCTGGAGCTGG + Intergenic
957918885 3:86722760-86722782 CTGGTTAGAAACTCTGGAGGTGG + Intergenic
958459551 3:94377556-94377578 CTGATTACAAACTCTGGGGCTGG - Intergenic
959544156 3:107574132-107574154 TTGAATACTCACTCTGAAGCAGG + Intronic
962122244 3:132574211-132574233 TTGCATGCAAACTCTGGAGCAGG - Intronic
962269396 3:133967025-133967047 CTGGATACTAACTCCCAAGGAGG + Intronic
967770826 3:193331758-193331780 CTGGATACTAACTCTGGAGCAGG + Intronic
968496851 4:923146-923168 CGGGATGCTAACCCTGGTGCAGG - Intronic
968949869 4:3684877-3684899 CAGGAGACCAGCTCTGGAGCTGG - Intergenic
974909552 4:68100282-68100304 CTGGAAATTTACTCTGGAGGAGG + Intronic
975432848 4:74315322-74315344 CTGGATATCAAGTCTGGAGTAGG + Intergenic
986755523 5:10832383-10832405 CTGGGTGCTAACTGTGGACCAGG - Intergenic
988258318 5:28849611-28849633 ATAGATACTAACTCTGGATATGG + Intergenic
992323471 5:75636948-75636970 CTGGAAACTGGTTCTGGAGCCGG + Intronic
993874954 5:93295585-93295607 CAACATATTAACTCTGGAGCTGG - Intergenic
995411667 5:111864545-111864567 CTGTATATTAAAACTGGAGCGGG + Intronic
1002668722 5:180847368-180847390 CCAGATCCTAACTCGGGAGCAGG - Intergenic
1004580261 6:16944172-16944194 CTGGATACTAGCTATGTAGCAGG - Intergenic
1012570927 6:100727585-100727607 CTGGGATCTAACACTGGAGCTGG - Intronic
1016194001 6:141309327-141309349 CTTGATAAGATCTCTGGAGCTGG - Intergenic
1021654367 7:22860613-22860635 GTGGAGACTGCCTCTGGAGCAGG + Intergenic
1022120227 7:27301007-27301029 CTGGAAAATAACTATGGAGAAGG - Intergenic
1022969768 7:35506051-35506073 CTGGACACTTACTCTGCAGCAGG + Intergenic
1024016798 7:45324703-45324725 CTGGATACAATCTCAGGAGTTGG + Intergenic
1024549931 7:50554254-50554276 CTGAACACTGACTCTGCAGCAGG - Intronic
1027123344 7:75537940-75537962 CTGGATGCTAACTAGGGAGGCGG + Exonic
1029877126 7:103765964-103765986 CTTGCTACTGACTCTGGAGGTGG - Intronic
1030608039 7:111659561-111659583 CTTGATAATAACTCTAAAGCAGG + Intergenic
1031521430 7:122771023-122771045 CATGATTCTAACTCTGCAGCAGG - Intronic
1031697773 7:124879986-124880008 CTGGCTATTAACTTTGCAGCTGG + Intronic
1032523077 7:132561070-132561092 CTGGATACTGACACTGGTCCTGG + Intronic
1034526830 7:151669644-151669666 GTGGATATTGAGTCTGGAGCTGG - Intronic
1039576310 8:38626600-38626622 CTGGAAACTGCCTCTGGAGTTGG - Intergenic
1043921952 8:85993253-85993275 TTGGCTACTAACACTTGAGCAGG - Intronic
1046205499 8:110990171-110990193 CTGGTTTCTAATTCTGGAGATGG + Intergenic
1046593691 8:116235881-116235903 CTGGATTCAAACTCTGGCCCTGG + Intergenic
1046736496 8:117781786-117781808 TTGAGTACTAACTCTGGATCAGG + Intergenic
1048772424 8:137909080-137909102 CTGGATACTCACTGTGGGGAAGG + Intergenic
1057145926 9:92759617-92759639 CTGAAGCCGAACTCTGGAGCAGG - Intronic
1059036798 9:110762457-110762479 CTGAATACTTACTATGGATCGGG + Intronic
1060744236 9:126119805-126119827 ATGGGTCCTAATTCTGGAGCAGG + Intergenic
1062462256 9:136666841-136666863 CTGGAGATTAACTCTGGGGATGG - Intronic
1186506411 X:10096578-10096600 CTGCATAGGAACTCTGAAGCAGG + Intronic
1188298607 X:28481092-28481114 CTGGACTCTCAGTCTGGAGCAGG - Intergenic
1189332016 X:40150017-40150039 CTGGATTCTGGCTCTGGAGCAGG - Intronic
1192190126 X:68985864-68985886 GTGGAGACCCACTCTGGAGCAGG - Intergenic