ID: 967779503

View in Genome Browser
Species Human (GRCh38)
Location 3:193419858-193419880
Sequence CACAGCTATCACTTGGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 1, 2: 3, 3: 57, 4: 551}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967779503_967779510 26 Left 967779503 3:193419858-193419880 CCAGGGCCCAAGTGATAGCTGTG 0: 1
1: 1
2: 3
3: 57
4: 551
Right 967779510 3:193419907-193419929 TACCCCAGCTTCACAGAGTATGG 0: 1
1: 0
2: 2
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967779503 Original CRISPR CACAGCTATCACTTGGGCCC TGG (reversed) Intronic
900499127 1:2991329-2991351 CCCAGCAATCGCTTGAGCCCAGG - Intergenic
900914467 1:5625562-5625584 CACAGGAATCACTTGAACCCAGG + Intergenic
901134070 1:6981819-6981841 CACAAAGATCACTTGAGCCCAGG - Intronic
901430157 1:9209267-9209289 CACATGTATCACTTGAGCCCAGG - Intergenic
901948576 1:12723568-12723590 CACAAGAATCACTTGAGCCCAGG - Intronic
902007643 1:13245121-13245143 CAGAACAATCACTTGAGCCCAGG - Intergenic
902026616 1:13388920-13388942 CAGAACAATCACTTGAGCCCAGG - Intergenic
902030122 1:13416246-13416268 CAGAGCAATGACTTTGGCCCTGG + Intronic
902302811 1:15514528-15514550 CAGAGCTAGGACTTGGGCCTAGG - Intronic
902886665 1:19409818-19409840 CAAAGCTATCATTTCGGCACTGG + Intronic
902995179 1:20219096-20219118 CAAAGTTGTCACTTGGGCACAGG - Intergenic
903630587 1:24766594-24766616 CACAAGAATCACTTGAGCCCAGG - Intronic
903729222 1:25478150-25478172 CACAGGAATCACTTGAGCCCAGG + Intronic
904144071 1:28376218-28376240 CACAGGAATCACTTGAGCCTAGG + Intronic
904764277 1:32830985-32831007 CACAACAATCACTTGAACCCGGG + Intronic
905305654 1:37016034-37016056 CACAGCAGCCACTTGTGCCCAGG + Intronic
905438350 1:37975421-37975443 CACAGGAATCACTTGAACCCAGG + Intronic
905593774 1:39188135-39188157 CACATTTAAGACTTGGGCCCTGG + Intronic
905633741 1:39534869-39534891 CAGAGGGATCACTTGAGCCCAGG + Intergenic
905731916 1:40303802-40303824 CTCACCTGTCCCTTGGGCCCCGG + Exonic
905840402 1:41171962-41171984 CAGAAGTATCACTTGAGCCCAGG + Intronic
905974089 1:42162932-42162954 CACAGATTTCACATGTGCCCGGG + Exonic
906278200 1:44534065-44534087 CACAAGAATCACTTGGACCCGGG - Intronic
906401058 1:45505021-45505043 CACAAGAATCACTTGGACCCAGG + Intronic
906963855 1:50437475-50437497 CAAAGTGATCACTTGAGCCCAGG - Intergenic
907022933 1:51086613-51086635 CATAGCTGTGGCTTGGGCCCTGG + Intergenic
907064484 1:51466800-51466822 CAGAAGTATCACTTGTGCCCAGG + Intronic
907375340 1:54033507-54033529 CACAAGAATCACTTGAGCCCGGG + Intronic
908700131 1:66890077-66890099 CACACAGATCACTTGAGCCCAGG + Intronic
909184404 1:72467412-72467434 CAGAGGGATCACTTGAGCCCAGG - Intergenic
909199800 1:72676742-72676764 CACAACAATCACTTGAGCCTGGG + Intergenic
909922592 1:81400716-81400738 CACAGCTGTCTTTTGGGCCCTGG + Intronic
910281496 1:85506504-85506526 GGCAGCTATTACTTGGGACCAGG - Intronic
910413395 1:86970491-86970513 CACAACAATCACTTGAACCCGGG - Intronic
910975485 1:92901748-92901770 CACAGCTGTTGTTTGGGCCCTGG + Intronic
911707543 1:101031089-101031111 CACAGCTATCTGTAGGGGCCAGG - Intergenic
912317249 1:108677124-108677146 CACAAGAATCACTTGAGCCCAGG + Intergenic
912588429 1:110788299-110788321 CACATCTGTCGTTTGGGCCCTGG - Intergenic
912703175 1:111893704-111893726 GACTCCTGTCACTTGGGCCCTGG - Intronic
914243165 1:145866320-145866342 CACAAGAATCACTTGAGCCCAGG + Intergenic
914257051 1:145969189-145969211 CAGAAGGATCACTTGGGCCCAGG - Intronic
914726816 1:150334794-150334816 CAGAGGGATCACTTGAGCCCAGG - Intronic
915176136 1:154016714-154016736 CAGGCCTATCACTTGGGCTCAGG + Intronic
916446311 1:164875524-164875546 CAGAGGGATCACTTGAGCCCAGG - Intronic
917108583 1:171520895-171520917 CACAACAATCACTTGAACCCAGG - Intronic
917328871 1:173861806-173861828 CACAACAATCACTTGAGCCTAGG + Intergenic
917541050 1:175915103-175915125 CACAAGTATCACTTGAACCCAGG + Intergenic
918050450 1:180968605-180968627 CACAAGTATCACTTGAGCCCGGG + Intergenic
919524655 1:198632924-198632946 CACAAGAATCACTTGGACCCAGG - Intergenic
920008844 1:202853172-202853194 CACAGCCATCACTGAGGCCTGGG - Intergenic
920524086 1:206653243-206653265 CACATGGATCACTTGAGCCCAGG - Intronic
920923843 1:210322724-210322746 CACAAGGATCACTTGAGCCCTGG + Intergenic
921400177 1:214713505-214713527 CAGAGGGATCACTTGAGCCCAGG - Intergenic
922809733 1:228408820-228408842 CACATCCACCACTAGGGCCCGGG - Intronic
923159733 1:231305794-231305816 CACAGCTATCATTAGGGACCCGG + Intergenic
923227668 1:231954231-231954253 CACAGCTATCTCTGTGTCCCTGG + Intronic
924229408 1:241951024-241951046 CACAAGAATCACTTGAGCCCGGG - Intergenic
1062909077 10:1200297-1200319 CCCAGCCATCACTGGGGCTCTGG + Intronic
1063370973 10:5523105-5523127 CAGAGCTGTAACCTGGGCCCAGG + Intergenic
1063408755 10:5820435-5820457 CACAGCTATTGCTGGGCCCCGGG + Intronic
1063700074 10:8375959-8375981 CAGGGGTATCACTTGAGCCCAGG - Intergenic
1065721230 10:28630221-28630243 CAGGGGTATCACTTGAGCCCTGG + Intergenic
1067124711 10:43506409-43506431 CAGGGTGATCACTTGGGCCCAGG + Intergenic
1068347428 10:55799792-55799814 CACAGGAATCACTTGAACCCGGG + Intergenic
1069121515 10:64575039-64575061 CAGAGGGATCACTTGGGCTCAGG + Intergenic
1069447265 10:68485180-68485202 CACAAGAATCACTTGAGCCCAGG - Intronic
1069802746 10:71092298-71092320 CAGAACGATCACTTGAGCCCAGG + Intergenic
1070024088 10:72615208-72615230 CACAAGTATCACTTGAGCCCAGG - Intronic
1070116938 10:73538110-73538132 CACGAGAATCACTTGGGCCCGGG + Intronic
1070164860 10:73889650-73889672 CACAAGAATCACTTGGGCCTGGG - Intergenic
1070203483 10:74231691-74231713 CAGACATATCACTTGAGCCCAGG - Intronic
1070543170 10:77431898-77431920 CACGGGAATCACTTGGACCCGGG + Intronic
1070590613 10:77798092-77798114 CACAACAATCACTTGAACCCAGG + Intronic
1071541312 10:86486861-86486883 CACAGGAATCACTTGAGCCCAGG + Intronic
1072554523 10:96504515-96504537 CACAGGAATCACTTGAACCCAGG + Intronic
1072792128 10:98325924-98325946 CACAAGAATCACTTGAGCCCGGG - Intergenic
1073118072 10:101103740-101103762 TGAAGCTATGACTTGGGCCCTGG + Intronic
1074393577 10:113078491-113078513 CTCAGCCATCACTTGATCCCAGG - Intronic
1074893343 10:117753647-117753669 CACAGGCATCACTGGGTCCCAGG + Intergenic
1075357585 10:121795153-121795175 CACAACAATCGCTTGAGCCCCGG + Intronic
1075613514 10:123873950-123873972 CACAAGAATCACTTGAGCCCTGG - Intronic
1076618208 10:131770815-131770837 AACAGCTGACACCTGGGCCCAGG + Intergenic
1077125278 11:931894-931916 CACAAGAATCACTTGGACCCAGG - Intronic
1077317481 11:1925870-1925892 CAGAGCCATCACTGGTGCCCAGG + Intronic
1077541754 11:3149801-3149823 CACAGCTGGCCCTTGTGCCCCGG - Intronic
1077590826 11:3489737-3489759 CAGGGCGATCACTTGAGCCCAGG - Intergenic
1078048963 11:7945447-7945469 CACAGCTGTTGTTTGGGCCCTGG + Intergenic
1078356548 11:10636265-10636287 CAGGGCAATCACTTGAGCCCAGG - Intronic
1078525604 11:12098790-12098812 CTCAGCTATCATATGGGCACTGG - Intronic
1078701509 11:13688885-13688907 CAGAGGGATCACTTGAGCCCAGG - Intronic
1079285781 11:19130936-19130958 CAGAAGAATCACTTGGGCCCAGG - Intronic
1079819020 11:25101185-25101207 CAGAACGATCACTTGAGCCCGGG + Intergenic
1079985772 11:27198775-27198797 CACAGTCATAACTTGAGCCCAGG - Intergenic
1080473589 11:32569915-32569937 CAGAGGAATCACTTGAGCCCAGG - Intergenic
1081893877 11:46568053-46568075 CACAAGAATCACTTGAGCCCTGG + Intronic
1081986112 11:47305675-47305697 CACAGCTGTCATTTGGGCCCTGG + Intronic
1082125623 11:48428407-48428429 CACAGATGAAACTTGGGCCCTGG - Intergenic
1082128345 11:48457314-48457336 CACAGCCAGCACTTGAGTCCAGG - Intergenic
1082250800 11:49977803-49977825 CACAGATGAAACTTGGGCCCTGG + Intergenic
1082559238 11:54599437-54599459 CACAGATGAAACTTGGGCCCTGG - Intergenic
1082561888 11:54628239-54628261 CACAGCCAGCACTTGAGTCCAGG - Intergenic
1082998748 11:59273059-59273081 TACAGCTTGCACTGGGGCCCAGG - Intergenic
1083024146 11:59535586-59535608 CACAAGAATCACTTGAGCCCAGG + Intergenic
1083839141 11:65293515-65293537 CACAAGTATCACTTGAACCCAGG + Intronic
1084246548 11:67861524-67861546 CAGGGCGATCACTTGAGCCCAGG - Intergenic
1084363563 11:68684234-68684256 CACAGCGATGACTTGGGCCACGG + Intronic
1084826133 11:71732976-71732998 CAGGGCGATCACTTGAGCCCAGG + Intergenic
1085075566 11:73588461-73588483 CAGGGGTATCACTTGAGCCCAGG + Intronic
1085143786 11:74173632-74173654 CACAAGAATCACTTGAGCCCGGG - Intronic
1085288863 11:75382882-75382904 CAGAGAAATCACTTGAGCCCAGG - Intergenic
1085728320 11:78974777-78974799 CACAGGAATCACTTGAGCCCAGG - Intronic
1088113018 11:106283477-106283499 CACTGCTATCACTCTGGTCCAGG + Intergenic
1088322912 11:108571574-108571596 CAGAGCTCTCACTTGGCCCCTGG + Intronic
1088330962 11:108651385-108651407 CAGATCGATCACTTGAGCCCAGG + Intergenic
1088544071 11:110942273-110942295 CACAGCCATCACTGGGGTTCTGG + Intergenic
1088899838 11:114107111-114107133 CAGAGCGATCACCAGGGCCCTGG - Intronic
1089439098 11:118499685-118499707 CACAGGAATCACTTGAACCCCGG + Intronic
1089476660 11:118769062-118769084 CAAAACGATCACTTGAGCCCAGG + Intronic
1090369975 11:126243369-126243391 CACAAGCATCACTTGGGCCCTGG + Intronic
1091494135 12:957695-957717 CACAAGAATCACTTGAGCCCAGG + Intronic
1092417109 12:8298647-8298669 CAGGGCGATCACTTGAGCCCAGG - Intergenic
1092810917 12:12270607-12270629 CACAGGAATCACTTGAACCCAGG + Intergenic
1093339189 12:17950212-17950234 CACAGCTATTGCTTGGACCCAGG - Intergenic
1096527450 12:52219698-52219720 CAAAGCTATTAGTTGGGTCCAGG - Intergenic
1096608704 12:52787083-52787105 CACAAGAATCACTTGAGCCCAGG + Intergenic
1096817009 12:54208095-54208117 CACAGCCTTCACTTAGGTCCAGG - Intergenic
1097121510 12:56736594-56736616 CACAAGAATCACTTGAGCCCGGG - Intronic
1097895172 12:64817968-64817990 CACAGAAATCACTTGAACCCAGG + Intronic
1098134973 12:67392398-67392420 CACAAGAATCACTTGAGCCCTGG + Intergenic
1098942365 12:76552331-76552353 CACAAGAATCACTTGAGCCCAGG + Intronic
1099617818 12:84960903-84960925 CAAAAGGATCACTTGGGCCCAGG + Intergenic
1100193587 12:92219252-92219274 CATATCTATCACTTGAGCCCAGG - Intergenic
1100538458 12:95534766-95534788 CACAGCAATCACGTGAGCCCAGG - Intronic
1100659869 12:96685461-96685483 CAAAGCAAACACCTGGGCCCGGG - Intronic
1101120939 12:101579498-101579520 CAGAGAGATCACTTGAGCCCAGG + Intronic
1101708686 12:107244668-107244690 CAGAGCCAGGACTTGGGCCCAGG + Intergenic
1102339711 12:112112013-112112035 CACAAGAATCACTTGAGCCCAGG + Intergenic
1102752022 12:115303199-115303221 CAGAGCTGTGATTTGGGCCCAGG - Intergenic
1103076615 12:117988246-117988268 CCCAGCTATCACTTGAACCCGGG + Intergenic
1103087097 12:118069898-118069920 CACAGCTGTCATTTGAACCCAGG + Intronic
1103589636 12:121982297-121982319 CAGAGGGATCACTTGAGCCCAGG - Intronic
1103599680 12:122046487-122046509 TGCAGCTATGACTGGGGCCCTGG - Intronic
1103655881 12:122470028-122470050 CACAGAAATCACTTGAACCCGGG - Intergenic
1103770447 12:123318638-123318660 CACAAGAATCACTTGGACCCAGG + Intronic
1103856728 12:123975515-123975537 CACAAGGATCACTTGAGCCCAGG - Intronic
1104864863 12:131947246-131947268 CACAAGAATCACTTGAGCCCAGG - Intergenic
1105295689 13:19086389-19086411 CACAGCACTCACTTCTGCCCTGG + Intergenic
1105455452 13:20536575-20536597 CACAAGAATCACTTGCGCCCAGG + Intergenic
1106105833 13:26732805-26732827 CACAAGAATCACTTGAGCCCAGG - Intergenic
1106294956 13:28403947-28403969 CACAGGAATCACTTGAACCCGGG + Intronic
1106421303 13:29588594-29588616 CACAGGAATCACTTGAACCCGGG - Intronic
1106731778 13:32548782-32548804 CACAAGGATCACTTGAGCCCAGG + Intergenic
1107101296 13:36596414-36596436 CAGGGGAATCACTTGGGCCCAGG - Intergenic
1107266873 13:38566393-38566415 CAGAAAGATCACTTGGGCCCAGG - Intergenic
1108134977 13:47346257-47346279 CCCAGCTATCACTTGAACCCGGG + Intergenic
1108347759 13:49563170-49563192 CACAAGGATCACTTGAGCCCAGG + Intronic
1108731711 13:53242196-53242218 CACAGCTGTCACCTGAGACCAGG - Intergenic
1108964346 13:56277556-56277578 CACAACAATCACTTGAACCCAGG + Intergenic
1111930829 13:94511450-94511472 CACAAGAATCACTTGGACCCAGG - Intergenic
1112474041 13:99714854-99714876 CACAAGAATCACTTGAGCCCAGG + Intronic
1115451993 14:33558351-33558373 CACAAGAATCACTTGAGCCCGGG - Intronic
1116073172 14:40074613-40074635 CACAGCTGTGGCTTGGGCTCTGG - Intergenic
1117949062 14:61062552-61062574 CACTGGGATCACTTGAGCCCAGG - Intronic
1118216247 14:63811346-63811368 CAGAGGGATCACTTGAGCCCAGG - Intergenic
1118568871 14:67172763-67172785 CACTGCTGTCATTTGGGCCCTGG - Intronic
1118844212 14:69534428-69534450 CACAGGAATCACTTGAACCCAGG + Intergenic
1118844873 14:69540101-69540123 CACAAGAATCACTTGAGCCCAGG + Intergenic
1118994986 14:70827468-70827490 CACAGCTGTTACATGGGCCAAGG - Intergenic
1119161574 14:72456989-72457011 CAGAAGTATCACTTGAGCCCAGG + Intronic
1119222063 14:72916829-72916851 CAGAAGGATCACTTGGGCCCAGG + Intergenic
1119421711 14:74511248-74511270 CACAGCTCCCACTCTGGCCCCGG + Exonic
1119637627 14:76289636-76289658 CACAGGAATCGCTTGGGCCCAGG + Intergenic
1121115352 14:91339165-91339187 CACAGCTCTGACGTGTGCCCCGG - Intronic
1121964284 14:98289815-98289837 CAGAACAATCACTTGGGGCCAGG - Intergenic
1122494728 14:102144794-102144816 CCCAAGAATCACTTGGGCCCGGG - Intronic
1122684721 14:103496351-103496373 CACATGGATCACTTGAGCCCAGG + Intronic
1124597282 15:31101792-31101814 CACAGCAATCATGAGGGCCCAGG - Intronic
1125291380 15:38151876-38151898 CACAGGAATCACTTGAACCCGGG - Intergenic
1125655569 15:41354146-41354168 CAGAAGTATCACTTGTGCCCAGG + Intronic
1126066253 15:44828318-44828340 CACAGCTATCAGTGTGGCCAGGG + Intergenic
1126093630 15:45072549-45072571 CACAGCTATCAGTGTGGCCAGGG - Intronic
1126273423 15:46848358-46848380 CACAACTATCATCTGGGCCCTGG + Intergenic
1127055062 15:55122853-55122875 CACAAGAATCACTTGGACCCAGG + Intergenic
1127635098 15:60861579-60861601 CAGAGAGATCACTTGAGCCCAGG - Intronic
1127719298 15:61684024-61684046 CCCAGCTGGGACTTGGGCCCGGG + Intergenic
1127796296 15:62441322-62441344 CACAGACATCACGTGAGCCCAGG - Intronic
1128634896 15:69296923-69296945 CAGAGCTAGAACTTGGACCCAGG - Intergenic
1129095974 15:73208632-73208654 CACATGGATCACTTGAGCCCAGG + Intronic
1130433305 15:83871316-83871338 CAGAAGGATCACTTGGGCCCAGG - Intronic
1131012189 15:89027453-89027475 CACAACAATCACTTGAACCCGGG + Intergenic
1131157181 15:90082380-90082402 CACACCACTCTCTTGGGCCCGGG - Intergenic
1132037730 15:98500849-98500871 CACAGCTGTCCTTTGGGCCCTGG + Intronic
1132107229 15:99071766-99071788 CACAGGAATCACTTGAACCCGGG - Intergenic
1132754987 16:1479543-1479565 CACAAGAATCACTTGAGCCCAGG + Intergenic
1133067580 16:3220182-3220204 CAGGGGGATCACTTGGGCCCAGG + Intergenic
1133132558 16:3686542-3686564 CACAACGATCACTTGAGCCTGGG - Intronic
1134351854 16:13444909-13444931 CACAAGAATCACTTGAGCCCAGG - Intergenic
1134665023 16:16012560-16012582 CAGAGGGATCACTTGGGCTCGGG - Intronic
1135161286 16:20098827-20098849 CACAAGAATCACTTGAGCCCAGG - Intergenic
1135729628 16:24883270-24883292 CAGGACAATCACTTGGGCCCAGG + Intronic
1136383474 16:29908183-29908205 CACAGCTCTCACGCTGGCCCTGG - Intronic
1136587000 16:31193053-31193075 CCCAGCTATCGCTTGAACCCAGG - Exonic
1138771278 16:59666999-59667021 CACAGCAAGGACTTAGGCCCAGG - Intergenic
1139358646 16:66382671-66382693 AACAGCATTCACTTGGCCCCTGG + Intronic
1139672262 16:68499796-68499818 CACAGCCCTCTCTTGGGTCCTGG - Intergenic
1139675820 16:68522871-68522893 CACAAGAATCACTTGGACCCGGG - Intergenic
1140056598 16:71530986-71531008 CACAGGAATCACTTGAACCCAGG + Intronic
1141184002 16:81774255-81774277 CACAAGAATCACTTGAGCCCAGG + Intronic
1141200603 16:81894778-81894800 CACAGGAATCACTTGAGCCTGGG + Intronic
1141478496 16:84290294-84290316 CACAGCCATGACTTTGGCCTTGG + Intergenic
1141516897 16:84551164-84551186 CACAAGGATCACTTGAGCCCAGG + Intronic
1141634261 16:85305375-85305397 CAGGGGGATCACTTGGGCCCAGG - Intergenic
1143050496 17:4121531-4121553 CACAACAATCACTTGAACCCAGG + Intronic
1143094874 17:4473478-4473500 CACAAGAATCACTTGTGCCCGGG - Intronic
1143149412 17:4798275-4798297 CACAGCTCTCGCTTTGGCCATGG + Exonic
1143456561 17:7071668-7071690 CACAGAGACCACTTGGGCCAAGG - Intergenic
1143565997 17:7721099-7721121 CACAAGAATCACTTGAGCCCGGG - Intronic
1143658054 17:8308733-8308755 CACAAGAATCACTTGAGCCCAGG - Intergenic
1146201032 17:30858771-30858793 CACAGGAATCACTTGAGCCCGGG - Intronic
1146737786 17:35253788-35253810 CACAAGAATCACTTGAGCCCAGG - Intronic
1146768069 17:35542210-35542232 CAGAGGAATCACTTGAGCCCGGG - Intergenic
1146982147 17:37173904-37173926 CACAGGAATCTCTTGAGCCCAGG - Intronic
1146983160 17:37185323-37185345 CAGAAGTATCACTTGGGCCCCGG - Intronic
1147451903 17:40510973-40510995 AACAGCTATCCCTTGGGCCCAGG + Intergenic
1147652593 17:42071002-42071024 CCCAGCTATTCCATGGGCCCAGG + Intergenic
1147906848 17:43829104-43829126 GACTGCTATCACTTTGGTCCTGG - Intronic
1148040876 17:44706161-44706183 CACAAGGATCACTTGAGCCCAGG - Intergenic
1148043505 17:44727324-44727346 CACAACAATCGCTTGGACCCGGG + Intronic
1148374619 17:47131759-47131781 CACAAGGATCACTTGAGCCCAGG - Intronic
1148907066 17:50918577-50918599 CAGAGGGGTCACTTGGGCCCAGG + Intergenic
1149232732 17:54554286-54554308 CACAGCTATTGTTTGGGTCCTGG + Intergenic
1149267129 17:54939144-54939166 CACATGGATCACTTGAGCCCAGG + Intronic
1149883548 17:60317284-60317306 CACAAGGATCACTTGAGCCCAGG + Intronic
1149987429 17:61357993-61358015 CACAAGAATCACTTGAGCCCGGG + Intronic
1150266141 17:63833548-63833570 CACAGCTTCCTCTGGGGCCCAGG - Intronic
1150374397 17:64668356-64668378 CAGAGGAATCACTTGAGCCCAGG + Intergenic
1150374718 17:64671505-64671527 CAGAGGAATCACTTGAGCCCAGG + Intergenic
1150424879 17:65069337-65069359 CACAAGGATCACTTGAGCCCAGG - Intergenic
1150535796 17:66038949-66038971 CACAGCTACCAATTGAGTCCTGG - Intronic
1150689963 17:67356781-67356803 CAGAGGGATCACTTGAGCCCAGG + Intronic
1150778016 17:68097435-68097457 CAGAGGAATCACTTGAGCCCAGG - Intergenic
1152131086 17:78476856-78476878 CACAGCATTCACTTGGGGCCAGG + Intronic
1152331775 17:79677716-79677738 CAGAGCTTTCTCGTGGGCCCAGG - Intergenic
1152714700 17:81893099-81893121 CACAGGAATCACTTGGACCTGGG - Intronic
1152999961 18:445723-445745 CAAAGGAATCACTTGAGCCCAGG - Intronic
1153022210 18:639670-639692 CACAAGTATCACTTGATCCCAGG + Intronic
1153826921 18:8883479-8883501 CACAAGGATCACTTGAGCCCAGG - Intergenic
1154006800 18:10537184-10537206 CAGAAGTATCACTTGAGCCCAGG - Intronic
1158464227 18:57675624-57675646 CAGAAGGATCACTTGGGCCCCGG - Intronic
1158611700 18:58946383-58946405 CACAAGAATCGCTTGGGCCCAGG - Intronic
1158945104 18:62441386-62441408 CACAGCAATCACCTGGTCCCTGG + Intergenic
1159329571 18:66973280-66973302 TACAACTATCACTTGTACCCAGG + Intergenic
1161537411 19:4828624-4828646 CACAAGAATCACTTGAGCCCAGG - Intronic
1161692521 19:5745033-5745055 CACAAGAATCACTTGAGCCCGGG - Intronic
1161902487 19:7129828-7129850 CAGGGGGATCACTTGGGCCCAGG - Intronic
1162250863 19:9442528-9442550 CACAGTAATCACTTGAACCCAGG - Intergenic
1162437404 19:10669959-10669981 CACAAGTATCGCTTGAGCCCAGG - Intronic
1162680646 19:12338338-12338360 CACAAGAATCACTTGAGCCCAGG - Intergenic
1163000818 19:14365676-14365698 CAGAGGGATCACTTGAGCCCAGG + Intergenic
1163621025 19:18360229-18360251 CACAAGGATCACTTGAGCCCAGG - Intronic
1163987736 19:20968997-20969019 CACAGCTGTGAGTTGAGCCCAGG - Intergenic
1164403293 19:27918586-27918608 CACCACTTTCACTGGGGCCCAGG + Intergenic
1165511251 19:36267969-36267991 CGCAGCCATCACTTGGGTCACGG - Intergenic
1165511800 19:36270496-36270518 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165512350 19:36272997-36273019 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165512897 19:36275538-36275560 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165513453 19:36278093-36278115 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165514003 19:36280627-36280649 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165514555 19:36283164-36283186 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165515107 19:36285697-36285719 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165515657 19:36288233-36288255 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165516209 19:36290770-36290792 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165516760 19:36293296-36293318 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165517313 19:36295819-36295841 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165517865 19:36298354-36298376 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165518416 19:36300889-36300911 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165518965 19:36303421-36303443 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165519515 19:36305936-36305958 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165520064 19:36308464-36308486 TGCAGCCATCACTTGGGCCATGG - Intergenic
1165624004 19:37270117-37270139 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165624550 19:37272658-37272680 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165625093 19:37275185-37275207 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165625627 19:37277723-37277745 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165626167 19:37280248-37280270 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165626708 19:37282775-37282797 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165627248 19:37285296-37285318 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165627789 19:37287824-37287846 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165628327 19:37290348-37290370 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165628867 19:37292873-37292895 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165629409 19:37295399-37295421 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165629950 19:37297924-37297946 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165630493 19:37300452-37300474 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165631030 19:37302990-37303012 TGCAGCCATCACTTGGGCCATGG + Intergenic
1165669114 19:37660365-37660387 CACAAGAATCACTTGAGCCCAGG + Intronic
1166650569 19:44571373-44571395 CACAAGGATCACTTGAGCCCAGG - Intergenic
1166817682 19:45556800-45556822 TACAGCTGTGACTTAGGCCCTGG + Intronic
1166997107 19:46724910-46724932 CACAGCCAACACTGGGCCCCTGG + Exonic
1167081726 19:47280593-47280615 CAGGAATATCACTTGGGCCCAGG + Intergenic
1167084751 19:47301602-47301624 CACAGGAATCACTTGAACCCGGG - Intronic
1168320585 19:55507249-55507271 CAGAAGAATCACTTGGGCCCTGG + Intronic
1168398525 19:56068801-56068823 CACAAGTATCACTTGAACCCAGG + Intergenic
925361082 2:3280759-3280781 CACAGCTTTCACTGTGGCACTGG - Intronic
926823686 2:16881182-16881204 CACAGGTACCAAGTGGGCCCTGG - Intergenic
927176236 2:20410857-20410879 CACATCTGTCATTTGGGCTCTGG + Intergenic
927446513 2:23166750-23166772 CTCAGGTACCACTTGGGCGCTGG + Intergenic
927556367 2:24036276-24036298 CAAGACTATCACTTGAGCCCAGG + Intronic
927993410 2:27464708-27464730 CACAGGAATCACTTGAACCCGGG - Intronic
928078106 2:28283661-28283683 CACACCTACCTCCTGGGCCCAGG - Intronic
928344198 2:30475224-30475246 CAGAAGTATCACTTGAGCCCAGG - Intronic
928406242 2:31017206-31017228 AACAGATATGACTTGGCCCCTGG + Intronic
928505395 2:31946768-31946790 CACAGGAATCACTTGAGCCCGGG + Intronic
928654963 2:33440983-33441005 CACAAGGATCACTTGAGCCCTGG - Intronic
928757950 2:34547902-34547924 AATAGCTCTCACTTTGGCCCTGG + Intergenic
929134086 2:38606216-38606238 CACACAGATCACTTGAGCCCAGG + Intergenic
929497366 2:42457721-42457743 CAGAAGGATCACTTGGGCCCAGG + Intronic
930740270 2:54825488-54825510 CAGAGAGATCACTTGAGCCCAGG - Intronic
931423539 2:62150310-62150332 CACACCGATCACTTGAGCTCAGG + Intergenic
932202471 2:69843559-69843581 CAGAAAGATCACTTGGGCCCAGG + Intronic
933048353 2:77568296-77568318 CACAGGAATCACTTGAACCCTGG + Intronic
933425090 2:82100570-82100592 CACAGCTATTACATGGGCTGAGG + Intergenic
935062427 2:99620199-99620221 CACAGCTGTGACTAGAGCCCTGG - Intronic
936454463 2:112661639-112661661 CACAAGAATCACTTGAGCCCAGG - Intronic
939317279 2:140567225-140567247 CACAGCTGTTGCTTGGACCCTGG - Intronic
939921751 2:148124185-148124207 CACAGGAATCACTTGAACCCAGG + Intronic
940867054 2:158827591-158827613 CAGATGGATCACTTGGGCCCAGG - Intronic
941059190 2:160826755-160826777 TACAGCTGTCATTTGGGCCTTGG + Intergenic
941450285 2:165652633-165652655 CACAATCATCACTTGAGCCCAGG - Intronic
943072862 2:183162412-183162434 CACAAGAATCACTTGAGCCCAGG - Intergenic
945111889 2:206367799-206367821 CACAAGGATCACTTGGACCCTGG - Intergenic
945264795 2:207880312-207880334 CACAGGAATCACTTGAACCCAGG + Intronic
945677432 2:212872472-212872494 CACACCTATCACTTGAGGTCAGG - Intergenic
946138603 2:217668777-217668799 CACAGCTAGAACTGGGGTCCTGG - Intronic
946721492 2:222613450-222613472 CACAAGTATCACTTGAACCCAGG + Intronic
947149957 2:227105281-227105303 CACAAGAATCACTTGAGCCCGGG - Intronic
947819370 2:233059727-233059749 CAGAGCCATCACTTGGACCTTGG + Intergenic
947858073 2:233338044-233338066 GACAGCTCTCACTTGGTGCCAGG + Intronic
948433049 2:237932563-237932585 CACAAGTATCACTTGAACCCTGG + Intergenic
948690852 2:239703873-239703895 CTGAGCGATCACTTGAGCCCAGG - Intergenic
1172415099 20:34759110-34759132 CAGAAGGATCACTTGGGCCCGGG - Intronic
1172488668 20:35316573-35316595 CAAAACTATCACTTGAACCCAGG - Intronic
1172774652 20:37400018-37400040 CACAGCTGACACTGGCGCCCAGG + Intronic
1173989260 20:47287762-47287784 CAGAGGGATCACTTGAGCCCAGG + Intronic
1174376185 20:50128215-50128237 CACAGCTGTCACTCGGGACGGGG + Intronic
1175150351 20:56928695-56928717 CACAACAATCACTTGAACCCGGG - Intergenic
1175331434 20:58167400-58167422 CCCAGCTTTCTCTTGAGCCCTGG - Intergenic
1175749702 20:61486794-61486816 CAGGAGTATCACTTGGGCCCAGG + Intronic
1175847972 20:62068818-62068840 CAGAAGGATCACTTGGGCCCTGG + Intergenic
1176193155 20:63823403-63823425 CACAAGAATCACTTGAGCCCAGG + Intronic
1176518972 21:7810812-7810834 CACAGGAATCACTTGAACCCTGG - Intergenic
1178232856 21:30807033-30807055 CACAGGCATCACTGTGGCCCAGG + Intergenic
1178312350 21:31539962-31539984 CACAAGGATCACTTGAGCCCAGG + Intronic
1178543316 21:33473358-33473380 CACAGGAATCACTTGAACCCAGG + Intronic
1178653000 21:34440825-34440847 CACAGGAATCACTTGAACCCTGG - Intergenic
1178856556 21:36255040-36255062 CACAAGAATCACTTGAGCCCAGG - Intronic
1179811877 21:43876949-43876971 CACAAGAATCACTTGAGCCCTGG - Intronic
1180616607 22:17132438-17132460 CAGGGGTATCACTTGAGCCCAGG + Intergenic
1181024766 22:20121829-20121851 CACGACAATCACTTGAGCCCAGG - Intronic
1181508495 22:23377844-23377866 CACAAGAATCACTTGAGCCCGGG + Intergenic
1182149278 22:28017217-28017239 CGCCGTTAGCACTTGGGCCCTGG - Intronic
1182442544 22:30372705-30372727 CACAGCTATGCCCCGGGCCCTGG - Intronic
1183069347 22:35385530-35385552 CAGGGGTATCACTTGAGCCCAGG - Intronic
1183336508 22:37250619-37250641 CACATAGATCACTTGAGCCCAGG + Intergenic
1183706772 22:39479108-39479130 CCGAGGTATCACTTGAGCCCAGG + Intronic
1183733696 22:39631959-39631981 CACAGCCCTCCCTGGGGCCCAGG - Intronic
1184222026 22:43107047-43107069 CACAAGAATCACTTGAGCCCAGG + Intergenic
1184562729 22:45272762-45272784 TCCAGCTATCACTGGGGCCTAGG + Intergenic
1185077297 22:48690254-48690276 CACAGTTACCACCTGGGCCAAGG - Intronic
951529235 3:23683101-23683123 CATAGAGATCACTTGAGCCCAGG - Intergenic
952190867 3:31021814-31021836 CCCAGCTATTGCTTGAGCCCAGG - Intergenic
952425235 3:33168740-33168762 CACAGAAATCACTTGAACCCAGG - Intronic
953153024 3:40342633-40342655 CACAAGAATCACTTGAGCCCAGG - Intergenic
953665583 3:44923708-44923730 CACAAGAATCACTTGAGCCCAGG + Intronic
954002411 3:47567917-47567939 CAGGGGTATCACTTGAGCCCAGG + Intronic
955153863 3:56396383-56396405 CACAAGAATCACTTGAGCCCAGG + Intronic
955285693 3:57639003-57639025 CAGAAGGATCACTTGGGCCCAGG + Intronic
955641607 3:61091718-61091740 CAGAGGGATCACTTGAGCCCAGG + Intronic
955991590 3:64633489-64633511 CACAGATATCATTTGTGTCCTGG + Exonic
956486825 3:69731870-69731892 CACAAGAATCACTTGAGCCCTGG - Intergenic
956503995 3:69918155-69918177 CACAGGAATCACTTGAACCCGGG - Intronic
956747057 3:72318647-72318669 CAAATCTATCCCCTGGGCCCAGG + Intergenic
957027929 3:75205822-75205844 CACAGCGATCACTTGAGGTCAGG - Intergenic
957166484 3:76680867-76680889 CACAACCATCACTTGAACCCGGG - Intronic
959093831 3:101932490-101932512 CACTGCAGTCACGTGGGCCCAGG + Intergenic
959652080 3:108760247-108760269 CACAAGGATCACTTGAGCCCAGG - Intergenic
961141324 3:124559156-124559178 CACAGCTATCACTGTGGAGCTGG + Intronic
961894659 3:130157243-130157265 CAGGGCGATCACTTGAGCCCAGG - Intergenic
962496397 3:135944729-135944751 CACAGCTATGACCTGCCCCCTGG - Intergenic
963139440 3:141935489-141935511 CAGACCAATCACTTGAGCCCAGG + Intergenic
963411079 3:144928792-144928814 CAGGGGTATCACTTGAGCCCAGG - Intergenic
964416266 3:156451661-156451683 CCCAAATATCACTTGTGCCCAGG + Intronic
964458527 3:156895516-156895538 CAGAGGGATCACTTGAGCCCAGG + Intronic
964947402 3:162243075-162243097 CAGAGCTATGACTTGATCCCAGG - Intergenic
966870582 3:184287796-184287818 CACAGCCATCTCTAGGGTCCTGG + Intronic
967760020 3:193213360-193213382 CACTGCCATCACCTGGGACCTGG - Intergenic
967779503 3:193419858-193419880 CACAGCTATCACTTGGGCCCTGG - Intronic
968022321 3:195404111-195404133 CACAAGAATCACTTGAGCCCAGG + Intronic
968203700 3:196779761-196779783 CAGAGGAATCACTTGAGCCCGGG - Intronic
968846347 4:3043933-3043955 CAAAGCTTTCACTTGGGCATGGG - Intergenic
968851621 4:3084295-3084317 CACAAGTATCACTTGAACCCAGG - Intronic
968931931 4:3585270-3585292 CACAGGAATCACTTGAACCCAGG - Intronic
969809140 4:9634371-9634393 CAGGGCGATCACTTGAGCCCAGG + Intergenic
970069598 4:12142542-12142564 CAGAGGGATCACTTGAGCCCAGG + Intergenic
971162532 4:24147849-24147871 CACAAGAATCACTTGAGCCCGGG + Intergenic
971854811 4:32029652-32029674 CAGAGGCATCACTTGAGCCCAGG - Intergenic
971936063 4:33149044-33149066 CAAAGATATCACTCGAGCCCTGG + Intergenic
972292730 4:37705008-37705030 CACAAGGATCACTTGGACCCGGG - Intergenic
972431595 4:38988314-38988336 CACAAGAATCACTTGAGCCCAGG - Intronic
973136795 4:46718483-46718505 CAGAAATATCACTTGAGCCCAGG + Intergenic
973536624 4:51889014-51889036 CACAAGAATCACTTGAGCCCAGG + Intronic
974462411 4:62205200-62205222 CACAAGAATCACTTGAGCCCGGG - Intergenic
974933133 4:68382994-68383016 CAAAAGGATCACTTGGGCCCAGG - Intergenic
975671791 4:76787523-76787545 CACATCTCTCATTTGGGCCTTGG - Intergenic
978813278 4:112875112-112875134 CACAACAATCACTTGAACCCAGG - Intronic
979795897 4:124846485-124846507 CAGAGCTATGACTTGGGGCGAGG + Intergenic
980354313 4:131723935-131723957 CGCAGCCATCACTTGGGCCATGG - Intergenic
980354850 4:131726441-131726463 CGCAGCCATCACTTGGGCCATGG - Intergenic
980355389 4:131728918-131728940 CGCAGCCATCACTTGGGCCATGG - Intergenic
980355936 4:131731419-131731441 CGCAGCCATCACTTGGGCCATGG - Intergenic
980356467 4:131733907-131733929 CGGAGCCATCACTTGGGCCATGG - Intergenic
980357008 4:131736395-131736417 CGCAGCCATCACTTGGGCCATGG - Intergenic
980357550 4:131738890-131738912 CGCAGCCATCACTTGGGCCATGG - Intergenic
980358087 4:131741376-131741398 CGCAGCCATCACTTGGGCCATGG - Intergenic
980358620 4:131743870-131743892 CGCAGCCATCACTTGGGCCATGG - Intergenic
980359162 4:131746343-131746365 CGCAGCCATCACTTGGGCCATGG - Intergenic
980359702 4:131748811-131748833 CGCAGCCATCACTTGGGCCATGG - Intergenic
980360241 4:131751306-131751328 CGCAGCCATCACTTGGGCCATGG - Intergenic
980360782 4:131753778-131753800 CGCAGCCATCACTTGGGCCATGG - Intergenic
980361327 4:131756261-131756283 CGCAGCCATCACTTGGGCCATGG - Intergenic
980361865 4:131758733-131758755 CGCAGCCATCACTTGGGCCATGG - Intergenic
980362410 4:131761216-131761238 CGCAGCCATCACTTGGGCCATGG - Intergenic
980362950 4:131763699-131763721 CGCAGCCATCACTTGGGCCATGG - Intergenic
980378332 4:131977293-131977315 CGCAGCCATCACTTGGGCCATGG + Intergenic
980942063 4:139284234-139284256 CACCTGTATCACTTGAGCCCAGG + Intronic
981071887 4:140549776-140549798 TAAAGGTATCACTTGAGCCCAGG - Intronic
981285946 4:143019549-143019571 CACAGCTGTCATTTGGGCTCTGG + Intergenic
981315019 4:143333672-143333694 CACAAGAATCACTTGGACCCGGG - Intergenic
981715975 4:147752618-147752640 CACAAGAATCACTTGAGCCCAGG - Intronic
982007599 4:151078329-151078351 CAGAGGGATCACTTGAGCCCAGG - Intergenic
982239067 4:153280475-153280497 CAGGGGTATCACTTGAGCCCTGG - Intronic
982350435 4:154409231-154409253 CATAGCTGTCACTTGGGCCCTGG - Intronic
982680417 4:158421631-158421653 CCCATCTATCATTTGTGCCCTGG - Intronic
982884731 4:160764555-160764577 CACAGGAATCACTTGGACCCGGG - Intergenic
983074651 4:163311103-163311125 CACAACAATCACTTGAACCCAGG - Intergenic
983610494 4:169639120-169639142 CACAAGTATCTCTTGAGCCCAGG - Intronic
984746496 4:183224651-183224673 CACAAGAATCACTTGAGCCCAGG - Intronic
985001556 4:185489522-185489544 CACAAGCATCACTTGAGCCCAGG - Intergenic
985718978 5:1479287-1479309 CAGGGAGATCACTTGGGCCCAGG + Intronic
986479226 5:8168166-8168188 CAGGGGGATCACTTGGGCCCAGG - Intergenic
986686377 5:10278534-10278556 CAAAGCCTTCACTGGGGCCCAGG - Intronic
988998617 5:36738400-36738422 CACAAGGATCACTTGAGCCCAGG - Intergenic
989323228 5:40160900-40160922 CACAGGAATCGCTTGAGCCCTGG + Intergenic
989405276 5:41054070-41054092 CACAAGAATCACTTGAGCCCGGG - Intronic
989595319 5:43151163-43151185 CACTGATATCACTTGGGCTCTGG - Intronic
990213670 5:53507858-53507880 CACAGCTTTCATTTTGCCCCTGG - Intergenic
990220655 5:53584858-53584880 CACAGGAATCACTTGAACCCAGG - Intronic
990863418 5:60353395-60353417 CACTGCTAGCAAATGGGCCCTGG + Intronic
991372914 5:65938461-65938483 CACACCTGTCACTTCAGCCCAGG - Intronic
992088413 5:73298158-73298180 CACAGCTTCCAGGTGGGCCCGGG + Intergenic
992555001 5:77894186-77894208 CAGAGGAATCACTTGAGCCCGGG + Intergenic
992650490 5:78854963-78854985 CACAGCTGTTATTTGGGCCCTGG + Intronic
993761726 5:91803413-91803435 CCCAGGTCTCACTTGGCCCCGGG - Intergenic
994198172 5:96942559-96942581 CACAAGAATCACTTGGACCCAGG + Intronic
994677246 5:102839442-102839464 CACAAGAATCACTTGAGCCCGGG + Intronic
994845425 5:104982786-104982808 CACAAAAATCACTTGAGCCCGGG - Intergenic
995149885 5:108830359-108830381 CACAAGAATCACTTGGACCCAGG + Intronic
995494939 5:112731852-112731874 CACAAGAATCACTTGAGCCCGGG - Intronic
995601948 5:113807061-113807083 CAGAGCTGTCACTTTGGCTCTGG + Intergenic
995984236 5:118148784-118148806 CAGAGGGATCACTTGAGCCCAGG + Intergenic
998126433 5:139625695-139625717 CACAGGAATCACTTGAGCCTGGG - Intronic
998161849 5:139817399-139817421 CACAGGCATTACTTGGGCCCAGG - Intronic
999438630 5:151583903-151583925 CACAAGAATCACTTGGGCCTCGG + Intergenic
999565230 5:152852242-152852264 CAGAGGAATCACTTGAGCCCAGG - Intergenic
1000323780 5:160156474-160156496 GGCAGGTATCACTTGGGCCCAGG + Intergenic
1001744432 5:174080652-174080674 CACAACCATCACTTGAACCCGGG - Intronic
1002271715 5:178076742-178076764 CACAAGGATCACTTGAGCCCGGG + Intergenic
1002656701 5:180754154-180754176 CACAGTTGTTGCTTGGGCCCTGG - Intergenic
1003601717 6:7523795-7523817 CACAAGAATCACTTGGACCCAGG + Intergenic
1003890537 6:10560179-10560201 CACAAGAATCACTTGAGCCCGGG - Intronic
1003895468 6:10603606-10603628 CACAACGATCACTTGAACCCAGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1004988169 6:21106481-21106503 CAAAAGGATCACTTGGGCCCAGG + Intronic
1005002601 6:21258213-21258235 CACAAGTATCACTTGAACCCAGG - Intergenic
1005300479 6:24465445-24465467 CACAAGAATCACTTGAGCCCAGG + Intronic
1005879073 6:30040549-30040571 CACAACAATCACTTGAACCCGGG + Intergenic
1006672309 6:35737072-35737094 CCTAGCTCTCACCTGGGCCCAGG + Exonic
1006786070 6:36668166-36668188 CACAGGGATCACTTGAGCCCAGG - Intergenic
1006991382 6:38217723-38217745 GACAGCCAACACGTGGGCCCAGG + Intronic
1007178258 6:39910997-39911019 CACTGATGTCACTGGGGCCCAGG - Intronic
1007380632 6:41488230-41488252 CACAGACAGCTCTTGGGCCCTGG + Intergenic
1007942364 6:45793828-45793850 CCCAGCACTCACTTGAGCCCAGG - Intergenic
1008028700 6:46668243-46668265 CACAAGAATCACTTGAGCCCAGG + Intronic
1008074572 6:47132373-47132395 CACAAGAATCACTTGAGCCCAGG - Intergenic
1008440942 6:51531288-51531310 AAAAGCTATCACATGGGCCTCGG + Intergenic
1009415489 6:63411745-63411767 CACAAGAATCCCTTGGGCCCAGG + Intergenic
1010193813 6:73220884-73220906 CACAAGGATCACTTGAGCCCAGG + Intronic
1010216010 6:73402670-73402692 CACAGCAATCACTTGAGCCTGGG - Intronic
1010600115 6:77814450-77814472 CCCAGCTACCACTTGGCCCATGG - Intronic
1010791964 6:80075252-80075274 CACAGCTATCATTTGGGCCCTGG + Intergenic
1011427564 6:87247060-87247082 CACAGGAATCGCTTGAGCCCAGG + Intronic
1011464549 6:87642066-87642088 CAGAGAGATCACTTGAGCCCAGG + Intronic
1012279782 6:97314976-97314998 CACAAGAATCACTTGAGCCCAGG - Intergenic
1012910456 6:105112074-105112096 CACTGGTATCACCTGGGCACTGG + Intronic
1013163891 6:107572394-107572416 CACAAGAATCACTTGAGCCCAGG - Intronic
1013206353 6:107949408-107949430 GACATAGATCACTTGGGCCCAGG + Intronic
1014050932 6:116953559-116953581 CAGGGCCATGACTTGGGCCCTGG + Intergenic
1015313851 6:131794807-131794829 TACAAGAATCACTTGGGCCCAGG - Intergenic
1016434674 6:144023867-144023889 CACAACAATCACTTGAGCCTGGG - Intronic
1016623564 6:146140359-146140381 CACAAGAATCACTTGAGCCCAGG - Intronic
1018245860 6:161823162-161823184 CAGAGGGATCACTTGAGCCCAGG - Intronic
1019572810 7:1720914-1720936 CACAGCTGGGACCTGGGCCCAGG - Intronic
1019630071 7:2044325-2044347 CACAGCCAGCACCTGGGACCAGG + Intronic
1020086674 7:5314197-5314219 CACAGGGATCGCTTGAGCCCAGG - Intronic
1020185381 7:5955070-5955092 CACAAGAATCACTTGCGCCCGGG + Intronic
1020218178 7:6211891-6211913 CACAACAATCACTTGAACCCAGG + Intronic
1020297532 7:6769679-6769701 CACAAGAATCACTTGTGCCCGGG - Intronic
1020397388 7:7731419-7731441 CACTGCTATCACTTTAGTCCAGG - Intronic
1020611953 7:10409101-10409123 CACAAGAATCACTTGAGCCCAGG - Intergenic
1021114526 7:16732554-16732576 CAGAAGTATCACTTGAGCCCAGG - Intergenic
1021500555 7:21328553-21328575 CACAAGGATCACTTGAGCCCAGG + Intergenic
1022012729 7:26323018-26323040 CAGAAGGATCACTTGGGCCCAGG + Intronic
1022081831 7:27030228-27030250 CAGAGGGATCACTTGAGCCCAGG - Intergenic
1023444912 7:40221581-40221603 CACAAGTATCACTTGAACCCGGG - Intronic
1023887310 7:44368323-44368345 CACAGCTGTCATTTGGGCCTTGG - Intergenic
1023925369 7:44665181-44665203 CACAGCAACCACTTGGGCCTAGG - Intronic
1025118284 7:56277401-56277423 CACAAGAATCACTTGAGCCCCGG + Intergenic
1025207645 7:57002935-57002957 CACAGGGATCGCTTGAGCCCAGG + Intergenic
1025295928 7:57775329-57775351 CACAGCCATCACTTTGGACATGG - Intergenic
1025664294 7:63573935-63573957 CACAGGGATCGCTTGAGCCCAGG - Intergenic
1026002778 7:66575047-66575069 CAGAGGGATCACTTGAGCCCAGG + Intergenic
1026515017 7:71061531-71061553 CACAAGAATCACTTGAGCCCAGG + Intergenic
1026914390 7:74111343-74111365 CACAAGAATCACTTGAGCCCCGG + Intronic
1027047581 7:75001303-75001325 CAGGGGTATCACTTGAGCCCAGG - Intronic
1028662505 7:93295951-93295973 CAGGAATATCACTTGGGCCCAGG - Intronic
1028696738 7:93722598-93722620 CAGAGGGATCACTTGAGCCCAGG - Intronic
1029709068 7:102289754-102289776 CATAACTCTCACATGGGCCCTGG - Intronic
1030200345 7:106896630-106896652 CCCAGCCATCACTTGTCCCCTGG - Intronic
1032811264 7:135420482-135420504 CACAAGAATCACTTGAGCCCAGG + Intronic
1033193858 7:139309776-139309798 CACAAGAATCACTTGAGCCCAGG + Intergenic
1034459502 7:151190774-151190796 CACACCTCTCTCCTGGGCCCTGG - Intergenic
1035156472 7:156918331-156918353 CCCAGCTATCACTTGAACCTGGG - Intergenic
1035389450 7:158495861-158495883 CACAGCTTTCATTTGAGCCTTGG - Intronic
1035399993 7:158558486-158558508 CCCAGCTACCAGTTGGTCCCAGG + Intronic
1035777293 8:2198185-2198207 CAGAGGGATCACTTGAGCCCAGG - Intergenic
1036517994 8:9463052-9463074 CAAAAGGATCACTTGGGCCCAGG + Intergenic
1036556222 8:9862579-9862601 CACAAGTTTCACTTGAGCCCAGG - Intergenic
1036609170 8:10334890-10334912 AACAGCCATCACGTGGGCCGAGG - Intronic
1037066575 8:14586304-14586326 CACAAGAATCACTTGAGCCCAGG - Intronic
1037117343 8:15242724-15242746 CACAACAATCACTTGAACCCTGG - Intergenic
1037867641 8:22459157-22459179 CGGAACGATCACTTGGGCCCAGG - Intronic
1038568861 8:28642351-28642373 CAGGACAATCACTTGGGCCCAGG + Intronic
1038830419 8:31052478-31052500 CACAAGAATCACTTGAGCCCAGG - Intronic
1039191632 8:34982806-34982828 CACAAGAATCACTTGAGCCCAGG + Intergenic
1039856992 8:41423773-41423795 CAGAGGGATCACTTGAGCCCAGG - Intergenic
1040427745 8:47306232-47306254 CACAACAATCACTTGAACCCAGG - Intronic
1040806619 8:51403580-51403602 CACACATATCACACGGGCCCTGG + Intronic
1040882649 8:52223549-52223571 CACAAGAATCACTTGAGCCCAGG + Intronic
1041105892 8:54443751-54443773 CACAGCTATCACCTGGAGCCAGG - Intergenic
1041245818 8:55887700-55887722 CACAGGAATCACTTGAACCCGGG - Intronic
1041345242 8:56890292-56890314 CAGAGCTTTCACGTGGGACCGGG - Intergenic
1041670658 8:60488385-60488407 CACAAGAATCACTTGAGCCCGGG + Intergenic
1042637445 8:70894280-70894302 CACAGCTGTTGTTTGGGCCCTGG + Intergenic
1042831831 8:73038374-73038396 CAGAAGTATCACTTGAGCCCAGG + Intronic
1043051867 8:75394806-75394828 CACAGGAATCACTTGAACCCGGG - Intergenic
1043173217 8:76991707-76991729 CAGAGCTAGAACTTGAGCCCAGG - Intronic
1043403008 8:79902203-79902225 CACAGGAATCACTTGAACCCAGG + Intergenic
1044662305 8:94603416-94603438 CACAAGGATCACTTGAGCCCAGG + Intergenic
1047722599 8:127655128-127655150 CACAAGAATCACTTGGACCCAGG + Intergenic
1047999349 8:130364835-130364857 CTCATCTCTCACTTGGGCTCAGG + Intronic
1048014756 8:130487343-130487365 CAGAAATATCACTTGAGCCCCGG - Intergenic
1048356846 8:133660914-133660936 CACAGGTAGCACGTGGGCCCTGG + Intergenic
1048577078 8:135701315-135701337 CACAGCTGTCATTTGGACTCCGG + Intergenic
1049079786 8:140433197-140433219 CACAAGAATCACTTGAGCCCGGG + Intronic
1049395146 8:142396707-142396729 CCCAGCCATGACTTGAGCCCTGG - Intronic
1049424446 8:142531886-142531908 CACAGATATCCCTTGGGGGCTGG + Intronic
1049663517 8:143831386-143831408 CAGGAGTATCACTTGGGCCCAGG + Intergenic
1050406577 9:5314722-5314744 GGCAGATGTCACTTGGGCCCTGG - Intergenic
1050800653 9:9608704-9608726 CACAGCTGTCACTTGAGGACTGG - Intronic
1051234192 9:14981086-14981108 CACAAGAATCACTTGCGCCCAGG - Intergenic
1051768269 9:20547721-20547743 CAGATAGATCACTTGGGCCCAGG + Intronic
1052166056 9:25329679-25329701 CAGAGAGATCACTTGAGCCCAGG - Intergenic
1052298617 9:26928593-26928615 CACAGCTAGGCCTTGCGCCCAGG - Intronic
1052672604 9:31577325-31577347 CACAGCAATCACTTGAACCCAGG + Intergenic
1052980057 9:34441574-34441596 CACAGGTATCACCTGGTCTCGGG - Intronic
1053210750 9:36225540-36225562 CACAAAAATCACTTGAGCCCGGG + Intronic
1053298359 9:36931112-36931134 CACAGGTATCCCTTGGGAGCTGG + Intronic
1053320896 9:37098042-37098064 CACAAGAATCGCTTGGGCCCGGG + Intergenic
1054877709 9:70113743-70113765 CACTGCTCTCACCTGGACCCTGG + Intronic
1056694317 9:88833420-88833442 CTCAGCTACCCCTTGAGCCCAGG + Intergenic
1057336693 9:94161191-94161213 CACAAGAATCACTTGGGCGCAGG - Intergenic
1058512707 9:105737502-105737524 CACAGCTGTGTCTTGGGCCCTGG + Intronic
1058680676 9:107437760-107437782 CACAAGAATCACTTGAGCCCGGG + Intergenic
1058760852 9:108130494-108130516 CATAGCTATCTCGTGGGACCCGG + Intergenic
1058856329 9:109066360-109066382 CACAGGAATCACTTGAGCCCAGG + Intronic
1059329789 9:113527645-113527667 CAAAGCTATCCCTAGGGCCAAGG - Intronic
1062612072 9:137379892-137379914 CACAGCTGCCACTGGGGGCCTGG - Intronic
1062634317 9:137482050-137482072 CAGAGCTGTCTCTTGAGCCCAGG - Intronic
1062727491 9:138083797-138083819 CACCGCTCTCATTTGAGCCCTGG - Intronic
1186155036 X:6716723-6716745 CACAGGGGTCACTTGGACCCAGG - Intergenic
1186406899 X:9312649-9312671 CAGGGCAATCGCTTGGGCCCAGG + Intergenic
1189288140 X:39866604-39866626 CACAGCCATCACGGGGGCCGGGG - Intergenic
1190410153 X:50129242-50129264 CACAAGAATCACTTGAGCCCAGG - Intergenic
1190866597 X:54390090-54390112 CAGGACTATCACTTGAGCCCAGG - Intergenic
1191850782 X:65584467-65584489 CACAAGAATCACTTGAGCCCGGG - Intergenic
1192096147 X:68213139-68213161 CAGGGGGATCACTTGGGCCCGGG + Intronic
1192757246 X:74059105-74059127 GACAGAGATCACTTGAGCCCAGG + Intergenic
1194158153 X:90418504-90418526 CACAAGAATCACTTGAGCCCGGG + Intergenic
1197159533 X:123308020-123308042 AACAGCTTTGACTTGGGCCTAGG + Intronic
1198978644 X:142367331-142367353 CACAGGAATCACTTGAACCCAGG + Intergenic
1199782284 X:151073610-151073632 CACAATGATCACTTGAGCCCGGG - Intergenic
1200504480 Y:3995468-3995490 CACAAGAATCACTTGAGCCCGGG + Intergenic
1200692365 Y:6319324-6319346 TACAGCTACAACTTGGGCACAGG - Intergenic
1201042907 Y:9855403-9855425 TACAGCTACAACTTGGGCACAGG + Intergenic
1201930745 Y:19343776-19343798 CACAAGAATCACTTGGGCCTGGG - Intergenic