ID: 967780443

View in Genome Browser
Species Human (GRCh38)
Location 3:193433378-193433400
Sequence TTTATTCATTAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 317}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967780439_967780443 3 Left 967780439 3:193433352-193433374 CCATTGCAGGAACATTAGGGAGA 0: 1
1: 0
2: 2
3: 16
4: 175
Right 967780443 3:193433378-193433400 TTTATTCATTAGAAGGTGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967780443 Original CRISPR TTTATTCATTAGAAGGTGGA GGG Intronic
900493284 1:2963708-2963730 TTCATTCATCAGATAGTGGATGG + Intergenic
902919705 1:19658417-19658439 TTTATTCATGAGAAGACTGAGGG - Intronic
904104064 1:28062448-28062470 TTTACTCTTTAGAAGTTAGAAGG + Intronic
907521209 1:55024424-55024446 TTTACTCTTAAAAAGGTGGATGG + Intergenic
908202915 1:61816146-61816168 TTTGTTCATTATAAAGTGGTTGG - Intronic
908560404 1:65300678-65300700 TTTATCCATTCGAATGTGAAAGG - Intronic
908726571 1:67183179-67183201 TTTATTCATTAGTAGGTAACTGG + Intronic
908954225 1:69601431-69601453 TTTAAACATTAAAAGATGGATGG - Intronic
909125752 1:71667178-71667200 TTTATTCCTTGGTAGGTGTAAGG + Intronic
911921827 1:103772934-103772956 TTTATTCATTCTACTGTGGATGG - Intergenic
913128435 1:115815051-115815073 TTTATTCTCTAGTAGGAGGAGGG - Intergenic
913267819 1:117061912-117061934 TTTTTTCATAATAAGTTGGAAGG + Intronic
914322406 1:146577893-146577915 ATTTTCCATTTGAAGGTGGATGG + Intergenic
915019054 1:152762526-152762548 TTTATTCATCAGTGGATGGATGG + Intronic
916185729 1:162130934-162130956 TTTATCCATAAAAAGATGGAAGG - Intronic
918714459 1:187769383-187769405 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
918731435 1:188002062-188002084 TTTATTCATTCAATGGTTGATGG + Intergenic
919476350 1:198036617-198036639 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
920832704 1:209479691-209479713 TTTGTTTTTTACAAGGTGGAAGG - Intergenic
920871129 1:209796116-209796138 TTAAAGCATTAGAAAGTGGAGGG - Intronic
921072090 1:211669305-211669327 TTTCTTCAACAGAAGGTCGATGG + Exonic
921184063 1:212655302-212655324 TGTCTTCATTAGAGGGTGGAAGG - Intergenic
921641773 1:217563322-217563344 TTTATTTATTTGAAGTTTGAAGG - Intronic
922068180 1:222164693-222164715 TTTATCCATTTGAATGTTGATGG - Intergenic
922436318 1:225610881-225610903 TTTATTCATTCTAAGGTTGATGG - Intronic
922906349 1:229176244-229176266 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
922953476 1:229579000-229579022 ATCATTCATAAGAAGGTGAAAGG + Intergenic
923220369 1:231887402-231887424 CTTTTCCATTTGAAGGTGGAAGG + Intronic
923909422 1:238423933-238423955 TTTATTCATTAAAATATTGATGG + Intergenic
1063693526 10:8310154-8310176 TATATATATTAGAATGTGGATGG - Intergenic
1063800838 10:9575583-9575605 TTGATTCATCAGATTGTGGAGGG - Intergenic
1064961234 10:20967214-20967236 TTTATTCATTCTCATGTGGATGG - Intronic
1065323367 10:24529464-24529486 TTTATTTTTTGGAATGTGGAGGG + Intronic
1066658416 10:37716616-37716638 TTTTTTCATTTGAAAGTAGAAGG + Intergenic
1067042916 10:42966301-42966323 TTTTTTCATTTGAAAGTGGAAGG + Intergenic
1067200018 10:44160524-44160546 TTTGTTCCTAAGAAGATGGATGG - Intergenic
1068569581 10:58614648-58614670 TTTATTCATCTGGAGGTTGAAGG + Intronic
1069214383 10:65801251-65801273 TTTTTCCCTTAGTAGGTGGAAGG + Intergenic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1071678606 10:87681928-87681950 TTTATCCATTAACAGGTTGATGG + Intronic
1071681394 10:87709408-87709430 TTTTATCATTAGAAGGAGGCTGG + Intronic
1071916154 10:90296829-90296851 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
1073239520 10:102047277-102047299 TCTATTCATTATAAAGTTGAGGG - Intronic
1075280793 10:121136486-121136508 TTTATTCATCAGCGGGTGTAGGG - Intergenic
1076288986 10:129329657-129329679 TTGCTTCATGAGATGGTGGAGGG - Intergenic
1079765966 11:24393361-24393383 TTTATTCATTAGTAAGCTGAAGG + Intergenic
1079997838 11:27314465-27314487 TTTATTCATTTACAGGTTGATGG - Intergenic
1080871292 11:36239440-36239462 TGTCTTCACTTGAAGGTGGAAGG - Intergenic
1082269841 11:50158277-50158299 TTTATTCATTAGTAAATAGAAGG + Intergenic
1085349715 11:75790646-75790668 TTTATTCCCTGGAAGGTGGCAGG + Exonic
1086271359 11:85070722-85070744 TTCATTCTTCAGAGGGTGGATGG - Intronic
1086574824 11:88328006-88328028 TTTATTCATCAGAGGGTGACTGG - Intronic
1086613395 11:88784625-88784647 TTTATTCAATAGAATGGGAAGGG - Intronic
1087048154 11:93861729-93861751 TTTTTTCATTGGAAAGTGCAAGG + Intergenic
1087196863 11:95311355-95311377 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
1089905857 11:122037811-122037833 TTTATCCATCACAAGGTTGATGG + Intergenic
1091017290 11:132063449-132063471 TCTATTAATGAGAGGGTGGAAGG + Intronic
1092066739 12:5596505-5596527 TTTATTCATTTTAAGGTGTGGGG + Intronic
1093447158 12:19273515-19273537 TTTATTTATTGGAATATGGAGGG + Intronic
1094087927 12:26614186-26614208 TTTTTCCCTTAGAAGATGGAGGG - Intronic
1094313638 12:29113984-29114006 ATTTTTCATTAGAAGGTTGATGG + Intergenic
1097585592 12:61512079-61512101 TTTATTAGCAAGAAGGTGGAAGG - Intergenic
1099955152 12:89346066-89346088 TTTCTTCTGTGGAAGGTGGAAGG - Intergenic
1100892196 12:99138174-99138196 TTTATTGATGAGAAGGTTGATGG + Intronic
1101470410 12:104991552-104991574 TTTATTCAGAAGAGGATGGAGGG + Intronic
1104793090 12:131496235-131496257 GCTATTCATGAAAAGGTGGATGG + Intergenic
1106236556 13:27866128-27866150 CATATTCATTTGATGGTGGAAGG + Intergenic
1106794072 13:33186265-33186287 TTGATTCATTAGAAAGTGTGTGG - Intronic
1106943393 13:34800469-34800491 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
1107220347 13:37973089-37973111 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
1107296706 13:38916789-38916811 TTTATTCAGTCGACCGTGGATGG + Intergenic
1108984920 13:56574869-56574891 TTTACACAGTGGAAGGTGGAGGG + Intergenic
1109087412 13:57992559-57992581 CTTGTTCATTAGTAGGTGAATGG - Intergenic
1109551934 13:63915303-63915325 TTTATTTTTCAAAAGGTGGAGGG + Intergenic
1111162708 13:84416756-84416778 TTTATTCATTTTAATGTGGGTGG + Intergenic
1111254721 13:85651407-85651429 TTTATTGATTATAATGTGGAAGG - Intergenic
1112109757 13:96283215-96283237 TTTATTACTTAGAAGGGGAAAGG - Intronic
1112405539 13:99116847-99116869 TTTTTTAATTAGAATGTTGAAGG - Intergenic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1113570133 13:111347658-111347680 CTTATTCCATAGAAAGTGGATGG + Intergenic
1114043218 14:18699192-18699214 TTTCTTCAACAGAAGGTTGATGG + Intergenic
1114047509 14:18889638-18889660 TTTCTTCAACAGAAGGTCGATGG + Intergenic
1114116705 14:19629770-19629792 TTTCTTCAACAGAAGGTCGATGG - Intergenic
1114320528 14:21543692-21543714 TTCATTCAGCAGAAGATGGAAGG + Intergenic
1114807054 14:25849712-25849734 TTTCTTACTTTGAAGGTGGATGG + Intergenic
1118289417 14:64505466-64505488 TTTGTTCAGTAAAAAGTGGAAGG + Intronic
1119375910 14:74192597-74192619 CATATTAATTTGAAGGTGGAGGG + Intronic
1120847416 14:89138754-89138776 GTGTTTCACTAGAAGGTGGAGGG + Intronic
1124896551 15:33782606-33782628 TTCATTCATTACAAAGTGGGTGG + Intronic
1126802743 15:52315187-52315209 TATATTCTTTAGAAGTTGAATGG + Intronic
1130132315 15:81154309-81154331 TAAATTCATAGGAAGGTGGAGGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131882567 15:96875720-96875742 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
1135245066 16:20848694-20848716 AATATTCATTACAAGGTGGCAGG + Intronic
1137403831 16:48174995-48175017 TTTATTTTTTAGAAACTGGATGG - Intronic
1139365623 16:66431306-66431328 TTAATTCATTAGAAGTTGTGGGG - Intronic
1140011217 16:71133276-71133298 ATTTTCCATTTGAAGGTGGATGG - Intronic
1141187100 16:81795866-81795888 TCTGTTCAATAGAAGGTGGGAGG - Intronic
1142320295 16:89377891-89377913 TTCATTGAGTAGAAGGAGGAGGG - Intronic
1144622816 17:16829322-16829344 TTTCTACATTGGAGGGTGGAAGG - Intergenic
1144883615 17:18443394-18443416 TTTCTACATTGGAGGGTGGAAGG + Intergenic
1145038517 17:19558806-19558828 TTTATTCATTACAAAGGGAAAGG - Intronic
1145148613 17:20500992-20501014 TTTCTACATTGGAGGGTGGAAGG - Intergenic
1148159204 17:45440542-45440564 ATTAATCATGAGAAGGAGGATGG + Intronic
1148802129 17:50235893-50235915 TATATTGATTTGAAGGTGGTGGG + Intergenic
1149129139 17:53274937-53274959 TTCATTCATTAGAAGATTTATGG + Intergenic
1149363273 17:55915648-55915670 TTAATTCATTCGATTGTGGAAGG - Intergenic
1149536800 17:57439494-57439516 TTCATTCATTAGATGGAGGATGG + Intronic
1149698160 17:58633366-58633388 TTTATTCATTATTAGGTGCTTGG - Intronic
1150490450 17:65570587-65570609 TTTATTCATTAGATGGAGTCTGG - Intronic
1154966581 18:21363614-21363636 TTTAGGCATTACAAGATGGATGG + Exonic
1155004958 18:21720495-21720517 TTTTTTTTTTAGAAAGTGGAAGG + Intronic
1155699127 18:28721558-28721580 TTGATTAATGAGAAGATGGAAGG - Intergenic
1160180291 18:76628795-76628817 TTTATTCATTTGTTGATGGATGG + Intergenic
1163070939 19:14840860-14840882 TTTGTTAATAAGATGGTGGAAGG - Intergenic
1164290634 19:23865922-23865944 GTTTTTCATCAAAAGGTGGAAGG - Intergenic
1164459281 19:28433774-28433796 TTTACTCTTAAAAAGGTGGATGG - Intergenic
1166433340 19:42745114-42745136 TTAATTTTTTAGAAGGTGTAAGG + Intronic
1166478472 19:43149999-43150021 TTTATTCATTCACAGATGGATGG - Intronic
1167046653 19:47053633-47053655 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
1167553601 19:50178271-50178293 TTTATCCATTCAATGGTGGACGG - Intergenic
925646203 2:6039518-6039540 TCTATTCATTAGGAGCAGGATGG + Intergenic
926464142 2:13167873-13167895 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
930955045 2:57194794-57194816 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
931847898 2:66223257-66223279 TTTATTCATTCATTGGTGGAAGG - Intergenic
932030220 2:68176183-68176205 TTTATACATTACAAAATGGAAGG + Exonic
934081906 2:88475762-88475784 CTTATTCATTAGCAGGAGAATGG - Intergenic
934878118 2:97945632-97945654 TTCATTCATTAGATTGTGCACGG + Intronic
935055189 2:99559875-99559897 CTTACTCATCAGTAGGTGGAAGG - Intronic
937740632 2:125348531-125348553 TTTCTGCAGTAGAAGGAGGAAGG + Intergenic
938424884 2:131178160-131178182 TTTCTTCAACAGAAGGTCGATGG + Intronic
939377203 2:141384113-141384135 TTTATTTTTTAAAAGGTGAAAGG + Intronic
939886640 2:147688407-147688429 TTTATTCTTTAGAACTGGGAAGG + Intergenic
939928946 2:148208054-148208076 CTTATTCTTTAGAAGGAGAATGG - Intronic
941353336 2:164460940-164460962 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
941372864 2:164688793-164688815 TTGGTTCAACAGAAGGTGGAGGG - Intronic
943390988 2:187267585-187267607 CTTATTGATGAGAATGTGGATGG + Intergenic
943425061 2:187721157-187721179 TTTATTCAATAAATGGTGCAGGG - Intergenic
943497908 2:188647910-188647932 TTAATTTAGTAGAAGGTGCAGGG - Intergenic
944136485 2:196405427-196405449 TTTATGCATTTGAAAGTGGTGGG - Intronic
944514833 2:200502406-200502428 GTTAGTCAGTAGAAGGTGAATGG - Intronic
947968070 2:234299022-234299044 TTTCTTCATTTGTAGCTGGATGG - Intergenic
1174737696 20:52981378-52981400 TTTATAGATTAGAAAGTGGAGGG - Intronic
1176097883 20:63352632-63352654 TTTGTGCCTCAGAAGGTGGAGGG - Intronic
1177366938 21:20151587-20151609 TGTATTCATAGGAAGGTAGATGG + Intergenic
1177587081 21:23110932-23110954 ATTAGTAATTAGAAAGTGGAGGG + Intergenic
1180466042 22:15612309-15612331 TTTCTTCAACAGAAGGTCGATGG + Intergenic
1184302077 22:43567316-43567338 TTGAATCATTAAAGGGTGGAAGG - Intronic
949190448 3:1243696-1243718 TTTACTCTTTAAAAGGTGGCTGG - Intronic
949924699 3:9031805-9031827 TGTCTTCATTAGAAGGTAGTGGG + Intronic
951490203 3:23261860-23261882 TTTATTCATTTATAGGTGTATGG + Intronic
951650499 3:24946400-24946422 TTTAGAAATTAGAAGGTGGTGGG + Intergenic
951884647 3:27512201-27512223 CTGATTCATTAGAAGGGGGAAGG - Intergenic
951968395 3:28415681-28415703 TATATTAATTATAAGGTGTAAGG + Intronic
951968699 3:28418841-28418863 TATATTAATTATAAGGTGTAAGG - Intronic
953077184 3:39581684-39581706 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
953443337 3:42939453-42939475 TTTATTCATTCTATTGTGGATGG + Intronic
954969317 3:54638367-54638389 TTTATTCTTAAAAAGGTGGCTGG - Intronic
955156878 3:56425652-56425674 TTTCTTCATTTGAATGTGTAAGG + Intronic
955695316 3:61629947-61629969 TTTGTTCAACAGAAGGTGGATGG + Intronic
956648073 3:71476420-71476442 TTCTTTCATTTGATGGTGGATGG + Intronic
957668601 3:83270111-83270133 TTTATTCAATAAAAGGTGCTGGG - Intergenic
957692044 3:83583508-83583530 TTTATTCATTAAATGGTGCTGGG - Intergenic
957748970 3:84387124-84387146 TTTATTCCTTAGAAAGAGAATGG + Intergenic
957832860 3:85545782-85545804 TTTTTTCCCTAGAAGGTGAATGG - Intronic
957928927 3:86852098-86852120 TTTATCCTTTATAATGTGGATGG - Intergenic
958483104 3:94669545-94669567 ATTATTCATTACCAGGAGGATGG - Intergenic
958502560 3:94933241-94933263 GATTGTCATTAGAAGGTGGATGG + Intergenic
959196801 3:103193540-103193562 TTTATTCTTTACAAGTTGGCAGG - Intergenic
960379087 3:116938270-116938292 TTTTGTGATTAGAGGGTGGAGGG - Intronic
960430147 3:117559281-117559303 TTTATGAATAAGATGGTGGAAGG + Intergenic
961584022 3:127907469-127907491 TCTCTGCATTAGCAGGTGGAAGG + Intergenic
962653037 3:137515477-137515499 TTTTTTCATTATAAGGATGACGG + Intergenic
963080589 3:141390046-141390068 TTTATTTATTAGAATGACGATGG - Intronic
964025396 3:152067499-152067521 AATATTAATTAGTAGGTGGATGG - Intergenic
964636458 3:158862645-158862667 TTTATGCATTAGAAGTTGCCAGG - Intergenic
964892315 3:161551815-161551837 TTTAGTCATTAGGAGGTTCAGGG + Intergenic
964984923 3:162726432-162726454 TTTACTCTTAAGAAGGTGGCTGG - Intergenic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
965605919 3:170497306-170497328 TTTATTCATTTCAAAGAGGAGGG + Intronic
965964816 3:174474658-174474680 TTTAAACACAAGAAGGTGGAAGG - Intronic
967780443 3:193433378-193433400 TTTATTCATTAGAAGGTGGAGGG + Intronic
968558659 4:1264477-1264499 TTTATTTAATAGAAGTGGGAGGG - Intergenic
969255909 4:6001663-6001685 TTTATTAAGTAAAAGGAGGAAGG - Intergenic
971770938 4:30896127-30896149 GTTGTTCATTAGAAAGTGAAAGG - Intronic
972387504 4:38581456-38581478 TTTTGTCATTAGAATGTGTACGG - Intergenic
972955559 4:44386302-44386324 TTTATTCATTTGTCTGTGGATGG - Intronic
973830312 4:54752794-54752816 TTTATTTTTTAAAAGGTGAAGGG - Intergenic
974175462 4:58316448-58316470 TTTTTACATTAAATGGTGGATGG + Intergenic
974215949 4:58847921-58847943 TTTATTCATTCGTTGGTTGATGG + Intergenic
976500963 4:85788458-85788480 TTTATTTTTTTGAAGCTGGAGGG + Intronic
976640151 4:87329302-87329324 ATTATTCTTTATAATGTGGATGG + Intergenic
977217208 4:94297102-94297124 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
977692595 4:99931965-99931987 TTTATTCTTTTGCATGTGGATGG - Intronic
978438563 4:108710849-108710871 TTTACTCTTTAAAAGGTGGCTGG + Intergenic
978815778 4:112903164-112903186 GTTTCTCATTGGAAGGTGGAGGG + Intronic
978849046 4:113310820-113310842 CTTATTCATGAAAAGGTGAAGGG - Intronic
979114857 4:116810525-116810547 TTTATTCATTAAAAAATGAAAGG + Intergenic
979130561 4:117039336-117039358 TTTATTCATTCAAAGATTGATGG + Intergenic
979214334 4:118144665-118144687 TTTATTTATCAGAAGATGTATGG + Intronic
979951495 4:126898668-126898690 TTTATTCATTCCAGAGTGGAGGG - Intergenic
981138427 4:141238940-141238962 TTTCTTCATCAGAAGGAGGTAGG + Intergenic
981811184 4:148776913-148776935 TTTATTAATTAGAATGTTTATGG + Intergenic
982180530 4:152745240-152745262 TTTATTCTTAAAAAGGTGGCTGG - Intronic
983032189 4:162816964-162816986 TTTATTAATTTGAAGTTGTATGG - Intergenic
983055431 4:163094912-163094934 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
986641607 5:9877227-9877249 CTTATTTTTTAGAAAGTGGATGG + Intergenic
987160616 5:15138231-15138253 TTTATTCATTCTACTGTGGATGG - Intergenic
987865641 5:23532928-23532950 TTTTTTCTGTAGAAGGTGGTTGG - Intergenic
990056430 5:51585963-51585985 TTTATTCCTCTGAAGATGGAAGG - Intergenic
990483330 5:56233168-56233190 TTTATTGATTTGGGGGTGGAGGG - Intronic
991366653 5:65875474-65875496 TTTATTCTATAGAAAGTGGTGGG - Intergenic
993515311 5:88825912-88825934 CTTATTCACTTCAAGGTGGAAGG + Intronic
993556851 5:89350248-89350270 TCTATTCATTATCAGGTGGCAGG + Intergenic
994000086 5:94768991-94769013 TTTATTCATTAAAATGTTGATGG - Intronic
994389752 5:99177825-99177847 TTTATCAATTAGAAGGCAGAAGG + Intergenic
994532595 5:100988142-100988164 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
995812191 5:116120109-116120131 TTTATTCATTTGTTGGTTGATGG - Intronic
996683546 5:126255261-126255283 ATTATTCATAAGGAGGTGGAAGG - Intergenic
996873948 5:128221152-128221174 TTTATTCATTAACTGGTTGAAGG - Intergenic
996905564 5:128596003-128596025 TTCATTCAGTAGATGGTGCAGGG - Intronic
996961130 5:129251363-129251385 TTTATCCATTAGTCGGTTGATGG + Intergenic
998606533 5:143640918-143640940 ACTACTCATTAGCAGGTGGAGGG + Intergenic
999397255 5:151238029-151238051 TTTAATCATCAGAACGCGGAAGG + Intronic
999594338 5:153185443-153185465 TTCAAACTTTAGAAGGTGGAAGG - Intergenic
1000113369 5:158130480-158130502 TTTAACCATTAGAAGGTGATGGG - Intergenic
1001170677 5:169416302-169416324 TTCATTACTGAGAAGGTGGATGG - Intergenic
1001431447 5:171665823-171665845 TGTATTCATTAGAAGGCTCATGG - Intergenic
1001665154 5:173426679-173426701 TTTATCCATTTGTCGGTGGATGG + Intergenic
1001926119 5:175638501-175638523 TTTCTTCATTTGAATGTGAATGG - Intergenic
1002800535 6:517910-517932 TTTATTCATTTAAAGATGGGTGG + Intronic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1003430223 6:6031670-6031692 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
1003573203 6:7269342-7269364 TTTCTTCATGGGAGGGTGGATGG - Intronic
1004768628 6:18757953-18757975 TTTACTCTTAAGAAGGTGGCTGG - Intergenic
1005222263 6:23599928-23599950 TTTATTCATTAGAAAGGTAAAGG - Intergenic
1006095771 6:31655840-31655862 GTTACTCATTAGCAGGTGAAAGG + Exonic
1006465095 6:34188803-34188825 TTTATTTATTAGTAGTTGGAAGG - Intergenic
1006544884 6:34772091-34772113 TTGAGTAATTAGAGGGTGGACGG + Intronic
1007348505 6:41251240-41251262 TTCAGTGATGAGAAGGTGGAAGG - Intergenic
1007460098 6:42011701-42011723 TGTATGCATTTGCAGGTGGAGGG - Intronic
1008331968 6:50256319-50256341 TTTATTTTTTAGATGGTGTAAGG + Intergenic
1009476517 6:64098536-64098558 TTTATTCCTGAGGAGGTGGTAGG + Intronic
1011138606 6:84128158-84128180 TTTAATCATTGAAAGGTGAATGG - Intronic
1011568498 6:88707385-88707407 TTTATTCTTTTGGGGGTGGAGGG + Intronic
1011856833 6:91703465-91703487 TTCATTCATCATATGGTGGAAGG + Intergenic
1012724556 6:102793020-102793042 TTTTTTCAGTAGGAGGTGTACGG - Intergenic
1013280445 6:108631468-108631490 TTTATTTTCTAGGAGGTGGAGGG + Intronic
1013580838 6:111533057-111533079 TTTATTCTGTATAGGGTGGAGGG - Intergenic
1013641209 6:112083805-112083827 TTTATTCACTACAATGTGGCTGG + Intronic
1014047198 6:116903833-116903855 TTTATTCATTCCATTGTGGATGG + Intronic
1014776535 6:125517277-125517299 TTTTTTTTTTAGAGGGTGGAGGG + Intergenic
1014937606 6:127402439-127402461 TTTATTCATTAAAAGGGAAAAGG - Intergenic
1015278100 6:131404634-131404656 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
1015288090 6:131508170-131508192 TTTACTCTTTAAAAGGTGGCTGG - Intergenic
1015364773 6:132385344-132385366 TATACTCAAAAGAAGGTGGAGGG - Intronic
1015583495 6:134751691-134751713 TTTATTGACTGGAAGGTCGATGG - Intergenic
1015842671 6:137490825-137490847 TTTATTATTTAGAAAGGGGAGGG - Intergenic
1016807972 6:148232273-148232295 TTTATTAATAAGAATATGGAAGG + Intergenic
1018606837 6:165606540-165606562 TTTGATCAATAGCAGGTGGAAGG - Intronic
1019074919 6:169379383-169379405 TTTACTCATTAGCATGTGGATGG - Intergenic
1021061771 7:16121391-16121413 TTTATTTTTTGGGAGGTGGAGGG - Intronic
1021977950 7:26028073-26028095 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
1021994533 7:26166914-26166936 TTTATTCATCTGGAGGAGGAGGG - Intronic
1022372820 7:29786668-29786690 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
1022854764 7:34303780-34303802 TTTATTCTTAAAAAGGTGGTTGG - Intergenic
1024179126 7:46871358-46871380 TTTATTCACATGAAGGTGAATGG - Intergenic
1024810886 7:53210895-53210917 CATATTCAGTAGAAGATGGAAGG - Intergenic
1025963384 7:66244964-66244986 TTTACTTATTAGAAGCTGTAGGG - Intronic
1027818464 7:83010793-83010815 TTTATTCTTTACATGGAGGAGGG - Intronic
1027832068 7:83190642-83190664 TTTCTTCATTAGAAGGAGACAGG - Intergenic
1028085095 7:86626365-86626387 ATCATTCACTAGATGGTGGAAGG + Intergenic
1028451598 7:90991340-90991362 TTGAATCATAAGAAGGTAGAGGG + Intronic
1031004617 7:116457305-116457327 TTTATTCTTAAAAAGGTGGCTGG + Intronic
1031007522 7:116490527-116490549 TTTATTCATTCTAATGTTGATGG - Intronic
1031399930 7:121317393-121317415 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
1032901202 7:136310579-136310601 TGTATTCAACAGAAGGTTGAAGG - Intergenic
1033829246 7:145232543-145232565 TTTATTTATTTTAAGATGGATGG - Intergenic
1034642134 7:152612678-152612700 TTTATTCATTTGTCGGTTGATGG + Intergenic
1035302308 7:157905767-157905789 TTGCTCCATTAGAAGGTGGGAGG + Intronic
1035823973 8:2624738-2624760 TTTGGTCATTAGAAGCTAGAAGG + Intergenic
1036629954 8:10505019-10505041 TTTAAACACAAGAAGGTGGAAGG + Intergenic
1037980967 8:23253953-23253975 TTTATTCTGTAGATGGTGGGTGG - Intronic
1038550224 8:28461043-28461065 TTTATTCTTTATAAGATGGTAGG + Intronic
1040698312 8:50029733-50029755 TTTATTCATTAGTCTGTTGATGG + Intronic
1041625209 8:60017669-60017691 TTTGTTGAGAAGAAGGTGGATGG + Intergenic
1041625999 8:60027808-60027830 TTTTTTCAGTGGAAGATGGAGGG + Intergenic
1042426556 8:68655817-68655839 TTTATCAATTATAAGGAGGATGG + Intronic
1042967247 8:74367810-74367832 TTTATGGATTAGACAGTGGATGG + Intronic
1043642580 8:82473888-82473910 TTTATTCATTTGACTGTTGATGG - Intergenic
1044032057 8:87250579-87250601 TTTATTCATTCAATGGTTGATGG - Intronic
1044148568 8:88746104-88746126 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
1044361493 8:91290000-91290022 TATAATCATTAGAATTTGGAAGG - Intronic
1044921933 8:97176902-97176924 TTTATTCTTAAAAAGGTGGCTGG + Intergenic
1046362216 8:113175811-113175833 ATTATTTTTTAGAGGGTGGAAGG - Intronic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1046822271 8:118647124-118647146 TTTATTCAGTGGAATGTAGATGG + Intergenic
1047706370 8:127503656-127503678 TTTATTCCTAAGAAGGAGGAAGG + Intergenic
1048854136 8:138672406-138672428 ATTATTCCTTGGAAGGTGGGGGG + Intronic
1051155137 9:14134589-14134611 TGTACTCATTACAAAGTGGAAGG + Intronic
1051857303 9:21583102-21583124 TTTATTCTCTAGATGCTGGAGGG + Intergenic
1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG + Intronic
1052062212 9:23974361-23974383 ATTATGCATAAAAAGGTGGAGGG - Intergenic
1053183585 9:35995140-35995162 TTTCTTGATTATAAGATGGAGGG + Intergenic
1053542262 9:38986426-38986448 TCTCTTCATTAGAAACTGGATGG + Intergenic
1053806714 9:41809945-41809967 TCTCTTCATTAGAAACTGGATGG + Intergenic
1054623878 9:67377485-67377507 TCTCTTCATTAGAAACTGGATGG - Intergenic
1055108097 9:72533229-72533251 TTTATGCATTATAAGGTGTGAGG - Intronic
1055611114 9:78025645-78025667 TTTCTCCCTCAGAAGGTGGAGGG - Intronic
1056218686 9:84429914-84429936 TTTAATCAAAAGAATGTGGAAGG - Intergenic
1056437294 9:86587199-86587221 TTTATTCTTAAAAAGGTGGCTGG - Intergenic
1059947136 9:119421096-119421118 TTTATTAATGAGAAAGAGGAAGG + Intergenic
1060127175 9:121059413-121059435 TTGATTCATTAGAAGGTCTAGGG - Intergenic
1060785000 9:126444393-126444415 TTTATCAATTGGAAGGTGAAGGG + Intronic
1061459090 9:130721743-130721765 TGTATACATTAGAAGGTGGGAGG + Intronic
1062144312 9:134980500-134980522 ATTCTTCACTGGAAGGTGGAAGG - Intergenic
1186053801 X:5627669-5627691 TTTCTTCATGGGAGGGTGGAAGG + Intergenic
1186173666 X:6903271-6903293 TTAATTCTTTGGAAGGTGAAAGG - Intergenic
1186274153 X:7921838-7921860 TTTCTTCTTTAGAAGTGGGATGG - Exonic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1188230304 X:27654200-27654222 TCTATTCATTATAATGTTGAGGG - Intronic
1189635926 X:43009258-43009280 ACTATTCATTAGAAGGTAGTGGG + Intergenic
1190567712 X:51747616-51747638 TTTAATCATTAGAATGTCAATGG + Intergenic
1190781002 X:53594729-53594751 TGTATTCTTTAGTAGGTGGGAGG - Intronic
1192165575 X:68825669-68825691 TTTATTCAGCAGAAGGTGGCAGG - Intergenic
1193505702 X:82340863-82340885 TGTACTTATTAGAAGGTGTAAGG - Intergenic
1193903617 X:87216004-87216026 TTTATCTATAAGAAGTTGGAAGG + Intergenic
1194293678 X:92104123-92104145 TTTATTCTTAAAAAGGTGGCTGG - Intronic
1195344287 X:103933767-103933789 TTTATTCATGATAAGTTTGAGGG + Intronic
1196131391 X:112160712-112160734 TTACTGAATTAGAAGGTGGAGGG + Intergenic
1196256563 X:113527010-113527032 TTTATCCATTAAAAAGTTGATGG + Intergenic
1197367455 X:125581550-125581572 TGCATTCACTAGAAGCTGGAAGG + Intergenic
1198009928 X:132541609-132541631 TTTATTCATTTGTACGTTGATGG + Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199156816 X:144559366-144559388 TTTATTCAATAGATGGTGCTGGG + Intergenic
1200611195 Y:5328665-5328687 TTTATTCTTAAAAAGGTGGCTGG - Intronic
1201524794 Y:14920152-14920174 TTTGTTCATCAGTAAGTGGAGGG + Intergenic