ID: 967781441

View in Genome Browser
Species Human (GRCh38)
Location 3:193444777-193444799
Sequence ACCTGGGAGAAGCTATGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967781441_967781445 21 Left 967781441 3:193444777-193444799 CCTTAACATAGCTTCTCCCAGGT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 967781445 3:193444821-193444843 GATCCTCAAAAGAGCCGAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 73
967781441_967781447 25 Left 967781441 3:193444777-193444799 CCTTAACATAGCTTCTCCCAGGT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 967781447 3:193444825-193444847 CTCAAAAGAGCCGAAGTGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 71
967781441_967781448 29 Left 967781441 3:193444777-193444799 CCTTAACATAGCTTCTCCCAGGT 0: 1
1: 0
2: 0
3: 11
4: 128
Right 967781448 3:193444829-193444851 AAAGAGCCGAAGTGGTAGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967781441 Original CRISPR ACCTGGGAGAAGCTATGTTA AGG (reversed) Intronic
901452183 1:9342605-9342627 ACATGGGAGAACCGATGTCAGGG - Intronic
903095157 1:20965115-20965137 ACCAGGGAAAAGTTATGTTTGGG - Intronic
906186522 1:43866230-43866252 ACCTGGGAGAAGCCATCTTTTGG + Intronic
910320292 1:85936296-85936318 ACAGGGGAGAGGTTATGTTAGGG - Intronic
912630437 1:111242249-111242271 ACCTGGGAGGAGCCATGATCTGG + Exonic
917595882 1:176528726-176528748 ACCTGAGAGAAGATAGGTTAGGG - Intronic
918085458 1:181241074-181241096 ACCTGGGAGATGCAGTGTGATGG + Intergenic
919597061 1:199577508-199577530 TCCTGGGAGCAGTTAAGTTACGG + Intergenic
922855126 1:228768637-228768659 TCCTTGGAGAAGGTAAGTTATGG + Intergenic
1063204265 10:3815758-3815780 ATCTGGAAGAACCTAAGTTAAGG + Intergenic
1067190233 10:44062409-44062431 ACCTGGGGTAAGCTGTGCTAAGG + Intergenic
1068931383 10:62593981-62594003 ACCCAGGAGAGGCTTTGTTAAGG - Intronic
1070161155 10:73867502-73867524 CCCTGGGAGGAGCTATTTTTAGG - Intronic
1070770817 10:79081379-79081401 ACCTGGGCTAAGCTATTTTCAGG - Intronic
1073488950 10:103839927-103839949 GCCTGGGAGAGGGCATGTTAGGG + Intronic
1074593858 10:114841813-114841835 CCCTGGGAGAAGTTAGTTTATGG + Intronic
1077915440 11:6608770-6608792 ACCTCGGAGAAGCTCTCTCAGGG - Exonic
1078305807 11:10184989-10185011 ACCTTGGGGACACTATGTTAAGG - Intronic
1079790569 11:24733482-24733504 ACCTGGAGGACGTTATGTTAAGG + Intronic
1081807641 11:45899210-45899232 ACCTCTGAGAAGCTAAGTCAGGG - Intronic
1082219508 11:49617611-49617633 TCCTGGGAGATCCTATGATAGGG + Intergenic
1084603862 11:70161755-70161777 ACCTGGGAGAAGCGAGGTTGGGG - Intronic
1086630123 11:89007161-89007183 TCCTGGGAGATCCTATGATAGGG - Intronic
1092658568 12:10714542-10714564 ACCCGGACGAAGCTATCTTAGGG + Intronic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1095842508 12:46709636-46709658 TCCTGTAAGAAGCTCTGTTAAGG + Intergenic
1097080216 12:56424824-56424846 AGCGGGCAGAAGCTATGGTACGG - Exonic
1100711501 12:97261757-97261779 TCCTGGGAGAAGATATGTCTGGG + Intergenic
1103727808 12:123007427-123007449 ACCTGGGAGAAGCAATCTCAGGG + Intronic
1104284189 12:127408535-127408557 ACCTTGGAAATGCTATGCTATGG - Intergenic
1106457909 13:29943811-29943833 TCCTGGGAGAGGCTCTGGTAAGG - Intergenic
1118073063 14:62267453-62267475 AACTGGGAGAAGCCATTTTCTGG + Intergenic
1119069318 14:71566228-71566250 ACCTAGCAGAAGATATGTAATGG + Intronic
1119703950 14:76772694-76772716 TCCTGGGAGAAGCCATGGTTGGG + Intronic
1128184625 15:65634142-65634164 ACCTGAGAGAAGCTGAGTGAAGG + Intronic
1129290810 15:74565872-74565894 CCCTGGAAGAAGCCAGGTTATGG - Intronic
1131354684 15:91734473-91734495 TGCTGGCAGAAGCTATGTGAGGG - Intergenic
1132205484 15:99983486-99983508 AGCTGGGAGAAGCTAGGGGAAGG - Intronic
1132760189 16:1505283-1505305 GCCTGGGAGAAGGTGTGTTCTGG - Intronic
1133154773 16:3865538-3865560 ACCTGGGAGGAGCTAGGTGGAGG + Intronic
1135053710 16:19213247-19213269 AGCAGGGACAAGCTACGTTAGGG - Intronic
1136070523 16:27784521-27784543 GCATGGGAGAAGCTCTGTGATGG - Intergenic
1139268963 16:65664254-65664276 CCCTTGGAGAAGCAATGTTTTGG + Intergenic
1139960834 16:70716434-70716456 ACCGGGGAGAAGGTATTTCAGGG - Intronic
1145978037 17:28995707-28995729 AGCTGGGAGAAGGTATGGTAGGG - Intronic
1146256326 17:31393011-31393033 ACATGGGAGAAGCTGGGTGATGG + Intronic
1149029243 17:52065190-52065212 ATCTAGGAGAAGCTAAGCTAAGG - Intronic
1151728800 17:75899076-75899098 GCCAGGGAGAAGCTTTGTTAGGG - Intronic
1153208677 18:2734357-2734379 ACCTTAGAGAAGGTATGATAGGG - Intronic
1154391748 18:13942608-13942630 ACCTCAGAGAAACTTTGTTAGGG + Intergenic
1155643145 18:28044333-28044355 ACCTTGGAGAAACAATGTAAGGG - Intronic
1158443121 18:57494926-57494948 ACCTGGGAGCAGCTACGTGGGGG - Intergenic
1158984796 18:62802940-62802962 ACCAGGGAGAAGCTCAGTGAGGG + Intronic
1159212260 18:65340278-65340300 ACCTGGGAAGAGCTTTGTGATGG - Intergenic
1159688322 18:71452307-71452329 ACCTGGAAGACATTATGTTACGG + Intergenic
1163047537 19:14655430-14655452 ATCTGGTAAAAGCTATGTAAGGG + Intronic
1164511298 19:28899350-28899372 AGCTGGCAGAAGCTCTGTGATGG + Intergenic
926007102 2:9380952-9380974 GCCTTGGAGAAGGTATGCTAGGG + Intronic
928700489 2:33894073-33894095 GCCTGGGAGAAGCTAAGATAAGG - Intergenic
928826910 2:35433736-35433758 AGCTGGAAGAAGATATGTCATGG - Intergenic
930771373 2:55133711-55133733 ATCTGGCAGGGGCTATGTTAAGG - Intergenic
931276482 2:60748017-60748039 TCCTGGGAGAAGCTAAGTGCAGG + Intergenic
933103158 2:78285561-78285583 AGTTGGGAGAAGCTATATTGGGG - Intergenic
934232056 2:90192955-90192977 AACTGGAATCAGCTATGTTAAGG - Intergenic
935571498 2:104665886-104665908 ACCTGGGAAGAGATAAGTTATGG - Intergenic
939466585 2:142563509-142563531 ACCTGCTAGACACTATGTTAAGG - Intergenic
943703305 2:191010108-191010130 TCCTGGGACAAACTATGTTTTGG - Intronic
943737792 2:191376175-191376197 ACCTGGAAGAAAAAATGTTAAGG + Intronic
944607977 2:201370159-201370181 ACCTGGGGGAAGGTCGGTTAGGG + Intergenic
944777048 2:202977448-202977470 ACGTAGGAGCAGCTATGTTATGG + Intronic
946733469 2:222731413-222731435 ACCTGGGAGAAGCTGAGCTATGG + Intergenic
948933122 2:241144891-241144913 AACAGGGAGAAGCTCTGTGATGG - Intronic
1169720914 20:8675357-8675379 ACCTGGGAGAAGATATAGCAAGG + Intronic
1170063681 20:12287498-12287520 AGCTGGGATAATCTATTTTAAGG + Intergenic
1175546296 20:59780187-59780209 ACCTGGGAGAAGCTGTCTGCAGG - Intronic
1179042504 21:37816321-37816343 ATCTGGGAGAAGCTATTGCAAGG + Intronic
1183033400 22:35122193-35122215 AAGTGAGAGAAGCTATGTTAAGG + Intergenic
949781596 3:7695147-7695169 CACTGTGAGAAGCTATGTCAAGG + Intronic
953493812 3:43369976-43369998 ACCTAAGAGAAGCCATCTTAGGG - Intronic
953591346 3:44258292-44258314 AACTGGGAGAAACTAGGTAAAGG - Intronic
955775228 3:62425756-62425778 TCCAAGGAGAAGCTCTGTTAAGG + Intronic
958982966 3:100746255-100746277 ACCTGGGGGAGGCTATGTGTGGG + Intronic
959901737 3:111669455-111669477 ATCTGGGAGAAACAATCTTATGG + Intergenic
964922092 3:161909417-161909439 ACGTGGCAGATGGTATGTTAAGG + Intergenic
966776244 3:183545054-183545076 ACCTGAGAGAAGCCAAGTGAGGG + Intronic
967506198 3:190255495-190255517 GCCTGGGGGAGGCTATTTTAGGG + Intergenic
967781441 3:193444777-193444799 ACCTGGGAGAAGCTATGTTAAGG - Intronic
969832583 4:9809603-9809625 GGCTGGGAGAAGGTATGTCATGG - Intronic
973787803 4:54349791-54349813 AGCTGGAAGGAGCTATGTCAAGG + Intergenic
976238716 4:82930377-82930399 ACCTGGTATAGGCTATTTTAAGG + Intronic
976369062 4:84266205-84266227 AACATGGAGAAGATATGTTAAGG - Intergenic
983106389 4:163691703-163691725 ATCCTGGAGAAGCTATGTTGAGG + Intronic
985772907 5:1824360-1824382 ACCTGGGAGAAGGTCTGAGAGGG + Intergenic
986853466 5:11840380-11840402 ACCTGAGAGAAGTAATTTTAAGG - Intronic
995252341 5:110007634-110007656 GGTTGGGAGAAGCAATGTTAAGG + Intergenic
996765721 5:127032109-127032131 ACCAGGGAGAAGGAATGTAAAGG + Intergenic
999454710 5:151705602-151705624 TCCTGGGAAAAGGTATGTGATGG + Intergenic
1000249584 5:159481354-159481376 ACCTGTGAGAAACAATATTAGGG + Intergenic
1000460837 5:161516271-161516293 ACCTGAAAGAAACTATGCTAAGG + Intronic
1004640627 6:17511846-17511868 CTCTGGAAGAAGCTATGGTAGGG - Intronic
1006238140 6:32653852-32653874 ACCTGGGGGACATTATGTTAAGG + Intergenic
1006396488 6:33790562-33790584 ACATGGGAGCAGCTAAGTCAGGG - Intergenic
1010424391 6:75710826-75710848 ACTTGAGAGAAGCTAACTTAAGG - Intronic
1012867544 6:104635737-104635759 ACCTGGTAAAAGCTAAGGTAAGG - Intergenic
1013513685 6:110866596-110866618 TCCTGTGAAAAGCTATGTTCAGG + Intronic
1014984609 6:127987840-127987862 ACCTAGTAGCAGCCATGTTAAGG - Intronic
1015128632 6:129784775-129784797 ACCTGGGAGGGGCAATATTAAGG - Intergenic
1015451608 6:133374697-133374719 GCCAGGGAGAAGCTTGGTTAAGG + Intronic
1016430621 6:143981507-143981529 ACCTAGGATAAGCTGTGTTTGGG + Intronic
1017573855 6:155779458-155779480 ACCTGGGAGAAGCTGGCTAAGGG + Intergenic
1023930380 7:44701641-44701663 CCTTGGGGGAAGCTATGTTTGGG + Intronic
1024420832 7:49164321-49164343 ACCTTGGAGAAGCAGTGGTAAGG - Intergenic
1026030369 7:66787667-66787689 ACCTGTGTGAAGCTTGGTTAAGG - Intronic
1026138282 7:67682786-67682808 ATGTGGGAGAAATTATGTTATGG + Intergenic
1028023859 7:85811520-85811542 ACCTTGTAGAAGCTATGTTGGGG + Intergenic
1028972140 7:96871214-96871236 CCCTGAGAGAAGCTGTGTTTGGG - Intergenic
1034220351 7:149440035-149440057 GGCTGGAAGAAGCTTTGTTATGG + Intronic
1035987384 8:4449764-4449786 AGTTGGGAGCAGCTATGTTTGGG + Intronic
1037829474 8:22179286-22179308 TCCTGGGAGAAGTTTAGTTAGGG + Intronic
1040853516 8:51925727-51925749 ACCTGGGACAAACTTTGTTTGGG - Intergenic
1041392999 8:57363978-57364000 ACCTGGGAGAAACATTTTTAAGG - Intergenic
1041945405 8:63435030-63435052 AGCTGGGAGAAGCTATACCACGG - Intergenic
1046205624 8:110992382-110992404 AACTGAGAGAAACAATGTTAAGG - Intergenic
1049372267 8:142273538-142273560 ACCTGGGAGAGGCTGTGCCAAGG - Intronic
1050622141 9:7465414-7465436 AGCTGGGAGAAGTGACGTTAAGG - Intergenic
1052247908 9:26360716-26360738 ACCTTGGTGATACTATGTTAAGG + Intergenic
1054813765 9:69455409-69455431 ACCTGGGAGCAGCTTAGTTCAGG + Intronic
1056039514 9:82648111-82648133 GTCTGGGGGAAGATATGTTAAGG + Intergenic
1056232218 9:84558389-84558411 ACCAGGGAGATGCTATCTCAAGG + Intergenic
1058456205 9:105140433-105140455 TCATGGTAGAAGCTATTTTAAGG - Intergenic
1060672660 9:125483624-125483646 ACATGGGAGACCCTTTGTTAGGG + Intronic
1186132983 X:6489624-6489646 ACCAGGGAGAAGCGTTGCTAGGG + Intergenic
1187853734 X:23616643-23616665 ACTCGGCAGAAGCTCTGTTATGG + Intergenic
1188647800 X:32591893-32591915 TCCTGGGAGAAGCAAAGTTGCGG + Intronic
1190330461 X:49232045-49232067 AACTGGGAGTAGCTGGGTTAAGG + Intronic
1192234067 X:69285139-69285161 ATCTGGGAGAAGCCATGCTCAGG + Intergenic
1192546606 X:72019387-72019409 ACCTGGCCTAAGCTATTTTATGG - Intergenic
1194107767 X:89792833-89792855 ATCTGGGAGAAACTCTGCTAGGG - Intergenic
1195889557 X:109677347-109677369 TTCTGGGAGGAGATATGTTAGGG - Intronic
1200359725 X:155592057-155592079 ACCTGGAGGATGTTATGTTAAGG + Intronic