ID: 967787681

View in Genome Browser
Species Human (GRCh38)
Location 3:193514960-193514982
Sequence GCAGAGTGAAGGAGTTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 485}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967787681 Original CRISPR GCAGAGTGAAGGAGTTGAGG AGG Intronic
900204859 1:1427470-1427492 GCAGGGTGATGGAGGGGAGGGGG - Intronic
900315542 1:2054409-2054431 GCTCAGTGCAGGAGGTGAGGGGG + Intronic
900339464 1:2181174-2181196 CCCGAGTGAAGGGGCTGAGGGGG - Intronic
901001503 1:6151137-6151159 GCAGAGTGAAGAAGATGAGAGGG - Exonic
901262711 1:7885637-7885659 GCAAGGTGAAGCAGGTGAGGCGG + Intergenic
902028257 1:13400780-13400802 GCAGAGTGTAGCATTTGAGATGG - Intergenic
902780501 1:18701837-18701859 GCAGAGGGAAGAAGGTGAGTGGG + Intronic
902884668 1:19396107-19396129 ACAGGGTGCAGGAGTAGAGGCGG - Intronic
903185430 1:21626310-21626332 GTAGAGTGAAGGAGTATAGGAGG + Exonic
903299793 1:22370638-22370660 GGAGAATGAAGCAGGTGAGGAGG + Intergenic
903753241 1:25643134-25643156 GCAGAGGGACGGGGTTGGGGAGG + Intronic
904052612 1:27648843-27648865 GGAGAATGCAGGAGTTGAGATGG - Intergenic
904054038 1:27658699-27658721 GCAGAGGGAAGGAGGCAAGGAGG + Intergenic
904260740 1:29286161-29286183 GCGGAGTGGAGGAGATGGGGGGG + Intronic
904436843 1:30504594-30504616 GCAGAGTGCGGGAGCTGTGGAGG + Intergenic
905207742 1:36352566-36352588 GCTGAGTGAGTGAGTTGAGGAGG - Intronic
905521331 1:38602902-38602924 GTAGAATGAAGGAGGGGAGGGGG + Intergenic
906280258 1:44548447-44548469 GCTGAATGAAGGAGTCTAGGTGG - Intronic
906294715 1:44642516-44642538 GCAGAGAGCAGGAGGTGCGGAGG + Intronic
906692798 1:47803874-47803896 GCAGAGTGCAGAAGTTGTAGGGG - Intronic
906699309 1:47846376-47846398 GCAGTGAGAAGGAGCTGATGTGG + Intronic
906951844 1:50341125-50341147 GCAGAGAGAAGGAGGAGAGTGGG - Intergenic
907094648 1:51766724-51766746 GCAGAGAGACAGATTTGAGGTGG - Intronic
907385544 1:54123081-54123103 GCAGAGTGAAGGAGCTCACAGGG - Intergenic
907813881 1:57899554-57899576 GTAGGGTGTAGGAGTTGGGGTGG - Intronic
908337870 1:63145721-63145743 GCTGAGTAAAGGAGTTTGGGAGG - Intergenic
909820936 1:80059943-80059965 GCAGAGTGAAGCAGGTGGGTTGG + Intergenic
909878946 1:80848340-80848362 GCAGAGTGAATGAGCTATGGGGG - Intergenic
910563196 1:88614749-88614771 TCAGACTGAAGGAGATGAAGGGG - Intergenic
910696806 1:90027395-90027417 GCAAATAGAAGGAGATGAGGAGG + Exonic
913109975 1:115648877-115648899 GCAGAGTGTAGGAGTTGTGAAGG + Intronic
914320506 1:146555012-146555034 GCAGTGTGAAGGAGTGAGGGGGG + Intergenic
916016331 1:160753062-160753084 GTAGAGTGAGGGAGGTGAGCAGG - Intronic
916680954 1:167104613-167104635 GCTTAGTGAAAGAGCTGAGGTGG - Intronic
916699949 1:167281924-167281946 ACTGAGTGAAGGAGATGAGCAGG - Intronic
916727639 1:167536972-167536994 GAAAAGTGAGGGAGATGAGGAGG + Intronic
920062619 1:203238123-203238145 ACAGAGAGAAGGAGGTGGGGAGG - Intronic
920871328 1:209797584-209797606 CCAGAGAGAAGGAGTCGAAGTGG - Intronic
922002458 1:221493872-221493894 GCAGAGTGAGCAAGGTGAGGTGG - Intergenic
922605492 1:226887476-226887498 GGAGAGTGAAGGACAAGAGGGGG - Intronic
923139831 1:231151771-231151793 ACAGAATGCAGGAGTTAAGGAGG - Intergenic
924315052 1:242786836-242786858 GCAGAGTGATGGGGTAGAGAAGG - Intergenic
924688923 1:246325283-246325305 GGAGGGAGAAGGAGTTGGGGGGG + Intronic
924724039 1:246651255-246651277 GCAGCGTGGAGGGGTGGAGGGGG - Intronic
1063375623 10:5552674-5552696 GCAGGATGAAGGACTTAAGGAGG - Intergenic
1066300543 10:34091932-34091954 GCAGAATGGAGGAGATGAGAGGG + Intergenic
1066476452 10:35751746-35751768 GCAGGGAGAAGAAGTTAAGGTGG - Intergenic
1066707976 10:38202002-38202024 GCAGAGTGAAGGCAGTGAAGAGG + Intergenic
1067071778 10:43138040-43138062 GTTGAATGAGGGAGTTGAGGCGG - Intergenic
1067438789 10:46296712-46296734 GGAGAGGAAAGGCGTTGAGGTGG + Intronic
1067935263 10:50605893-50605915 GAAGGGTGAAGGGGTTGAAGTGG - Intronic
1068293240 10:55033052-55033074 GCAGAGTGCATGAGCTGTGGAGG + Intronic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1070725136 10:78782568-78782590 GTGGAGTGGAGGACTTGAGGAGG - Intergenic
1071114999 10:82207745-82207767 GAAGAGTGAATGAGTGAAGGGGG + Intronic
1071243618 10:83738641-83738663 GGAGAATGAAGGAGTAGAGAAGG + Intergenic
1073570227 10:104575197-104575219 GCACAGTGAGGGAGGAGAGGGGG - Intergenic
1073683368 10:105728511-105728533 ACAGAGAGAAGGAGTGGGGGGGG - Intergenic
1073743915 10:106443868-106443890 GTAGAGTGATGGAGGGGAGGTGG + Intergenic
1076762177 10:132611317-132611339 GGAGAATGAGGGAGGTGAGGTGG + Intronic
1076762191 10:132611362-132611384 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762230 10:132611496-132611518 GGAGGGTGACGGAGGTGAGGTGG + Intronic
1076762247 10:132611541-132611563 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762280 10:132611631-132611653 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1076762297 10:132611676-132611698 GGAGGGTGAGGGAGGTGAGGTGG + Intronic
1078634792 11:13039361-13039383 GTGGAGTGCAGGAGTGGAGGGGG + Intergenic
1078849248 11:15149198-15149220 GCAGGGTGACGGAGTCCAGGTGG - Exonic
1079247220 11:18761499-18761521 GAAGAGTGAAAGAGAAGAGGAGG + Intronic
1079354935 11:19723019-19723041 GCAGACTGGAGGGGTTGAGAGGG + Intronic
1079685272 11:23351823-23351845 ACAGAGTGCAGGATTTGTGGAGG + Intergenic
1080128926 11:28770399-28770421 GCAGAATGCAAGAGTTGTGGAGG + Intergenic
1080377107 11:31725437-31725459 GCAGAGAGAAGGGGTGGTGGTGG - Intronic
1080388125 11:31822073-31822095 GCTGAGAGAGGGAGATGAGGGGG + Intronic
1080637681 11:34138161-34138183 CCAGAGTGCAGGCCTTGAGGAGG + Intronic
1081458211 11:43246364-43246386 CCAGAGTGCAAGAGTTGAGTTGG + Intergenic
1081700961 11:45152396-45152418 GCAGAGAGAGGGTGTTGGGGTGG - Intronic
1081737294 11:45412887-45412909 GCTGGGTGAAGGAGTGGAGGGGG - Intergenic
1081773174 11:45662187-45662209 ACAGAGTAAAGGGGTTGGGGTGG - Intronic
1081952561 11:47057623-47057645 GCAGTGTTATTGAGTTGAGGAGG + Intronic
1082773116 11:57224124-57224146 GCATAGGGAATGAGTTGAAGGGG - Intergenic
1082862372 11:57868440-57868462 GCAGAGTGCAAGAGTGAAGGAGG - Intergenic
1083802170 11:65053136-65053158 GCAGTGTGAGGGAGAGGAGGTGG + Intronic
1084187960 11:67485090-67485112 GCAGAGTGAAGGAGGGGGTGGGG - Intronic
1085349071 11:75786710-75786732 GCAGAGGGAAGGAGTGGCTGGGG - Intronic
1085851385 11:80124405-80124427 ACAGAGTGCAAGAGTTGTGGGGG + Intergenic
1085890905 11:80578030-80578052 ACAGAGAGATGGAGTTGGGGTGG + Intergenic
1087013474 11:93534675-93534697 GCAGAGAGCAGGAGTGGTGGAGG - Intronic
1088911738 11:114197390-114197412 TCAGTGTGAAGGAGTCTAGGAGG + Intronic
1089983335 11:122790335-122790357 GCAGAGTGAGGGAGAGGGGGAGG - Intronic
1090319234 11:125827678-125827700 GCTAAATGAAGGAGTTGGGGAGG + Intergenic
1090382180 11:126335190-126335212 GCAGAGAGCAGGAGGTGATGAGG + Intronic
1090407535 11:126486123-126486145 GCAGAGTGGAGGAAGGGAGGTGG + Intronic
1090806260 11:130204210-130204232 GTTGAGTGAATGAGTTGATGGGG + Intronic
1091323870 11:134669826-134669848 ACAGAGTGAAGAAGCAGAGGCGG + Intergenic
1091600728 12:1916203-1916225 GCAGGGGGAATGAGCTGAGGAGG + Intronic
1091632174 12:2170601-2170623 GAAGAGTGAGGGAGTTGAGGTGG + Intronic
1091659303 12:2371381-2371403 GCAGAAAGAAGGCGTTGAAGGGG + Intronic
1091794511 12:3290080-3290102 ATTGAGTGGAGGAGTTGAGGTGG - Intergenic
1092715630 12:11386927-11386949 GCAGACTGAAGAATTGGAGGTGG + Intronic
1093780232 12:23127127-23127149 GCAGAGTGAAGAAGTGGTGCTGG - Intergenic
1094243078 12:28251629-28251651 CCAGTATGAAGGAGATGAGGAGG - Intronic
1095148643 12:38763263-38763285 GCAGAGTAAATGGGTTGATGTGG + Intronic
1095630003 12:44365222-44365244 GCAAAGTGAAGGAATGGAAGTGG - Intronic
1095648825 12:44582690-44582712 GTAGAATGAAGGAGGTGAGAAGG + Intronic
1095895133 12:47272495-47272517 TCAGAGTGAAGCAGTAGAAGTGG + Intergenic
1095971168 12:47902915-47902937 GTAGAGTGTAGGGGTTCAGGAGG + Intronic
1096199672 12:49672711-49672733 GCAGTGGGAAGGAAATGAGGAGG - Intronic
1096712370 12:53466791-53466813 GGAGAGGGAAGGAGATGAGGGGG - Intronic
1096753961 12:53783375-53783397 GCAGAGAGACCTAGTTGAGGGGG - Intergenic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1098921135 12:76303249-76303271 GGAGAATGAATGGGTTGAGGTGG - Intergenic
1099990374 12:89714661-89714683 ACAGAGTGAAAGAGTGAAGGAGG - Intergenic
1100356764 12:93838378-93838400 GTAGAGTGGTGGAGTGGAGGAGG - Intronic
1101147655 12:101856215-101856237 GCAGAGTGAAGGTGGTGTAGGGG - Intergenic
1102230344 12:111257545-111257567 GAAGAGTGAAGGGGAGGAGGAGG - Intronic
1102596821 12:113999240-113999262 GCAGAGTCCAGAAGTTGGGGAGG + Intergenic
1102731940 12:115119180-115119202 GCACAGTGAGGGAGTGGAAGGGG + Intergenic
1103523120 12:121549400-121549422 GGACAGGGAAGGAGATGAGGTGG + Intronic
1103604518 12:122077300-122077322 GCAGAGTGCAGGAGTGGCTGTGG + Intergenic
1104102324 12:125624348-125624370 GCAGAGTAAATGAGATGAAGTGG - Intronic
1104666568 12:130651355-130651377 GCAGGGCGATGGCGTTGAGGAGG + Intronic
1105205704 13:18221726-18221748 GCTGAGTGAAGGACCTGAGATGG - Intergenic
1105455152 13:20533623-20533645 GCAGAGAGAGGGAATTGAGAGGG + Intergenic
1106662116 13:31810617-31810639 GCAGAATGTAAGAGTTGGGGAGG + Intergenic
1107712460 13:43163799-43163821 GAAGAGTGAAGGAATCAAGGTGG - Intergenic
1108013536 13:46048668-46048690 GTAGGGTGAGGGAGGTGAGGAGG - Intronic
1108028168 13:46200360-46200382 GCAGAGAGAAAGGGTTGGGGTGG + Intronic
1108473183 13:50787849-50787871 GCAGAGGGAAGGCGCTGAGCTGG - Intronic
1108746368 13:53398906-53398928 TCAGAGGGAAGGAGATAAGGGGG - Intergenic
1110671972 13:78191272-78191294 GCAGAGTGGTGCAGTGGAGGGGG - Intergenic
1112006198 13:95255760-95255782 CCAGAGTGCAGGTGTGGAGGGGG - Intronic
1112070721 13:95846414-95846436 GCAGAGGGGAGGAGGGGAGGGGG + Intronic
1112430147 13:99343729-99343751 GCTGAGTGAAGAAGTTCAGCAGG - Intronic
1114515339 14:23296041-23296063 GCACTGTGAAGGAACTGAGGAGG + Exonic
1114787116 14:25613579-25613601 TGAGAGTGAAGGAATGGAGGAGG + Intergenic
1115087493 14:29535132-29535154 GAAGAGTGAAGTAGATGAGAAGG + Intergenic
1115223508 14:31080745-31080767 GCAGGGTGACGAAGTTGGGGAGG - Intronic
1116364339 14:44040961-44040983 GCAGATTGCAGGAATAGAGGAGG + Intergenic
1116941804 14:50798184-50798206 GGAGAGAGAAGTAGTTGGGGAGG - Intronic
1117517402 14:56515400-56515422 GCAGAGTGAAGCAGGGGATGGGG - Intronic
1118064093 14:62171745-62171767 AGAGAGAGAAGGAGTGGAGGAGG - Intergenic
1118566108 14:67142762-67142784 TTAGAGTGAAGGACTTGAGTGGG - Intronic
1118725886 14:68628696-68628718 GCAGAGGGTAGGGGGTGAGGAGG + Intronic
1118925938 14:70189477-70189499 GCCTAGGGGAGGAGTTGAGGGGG + Intergenic
1119217993 14:72884030-72884052 GGAGAGAGAAGAAGTGGAGGCGG - Intronic
1119714658 14:76850428-76850450 AGAGAGTGAAGGAGGGGAGGGGG + Intronic
1120437044 14:84495054-84495076 ACAGAGTGCAGGAGTTAAGGAGG + Intergenic
1121424170 14:93836474-93836496 GCAGAGTGAAAGAGTGAAGCAGG + Intergenic
1121843974 14:97157190-97157212 GCCAAGTGATGGTGTTGAGGAGG + Intergenic
1122531991 14:102434746-102434768 GCACAGTGAGTGAGTTCAGGAGG - Exonic
1122737193 14:103849576-103849598 CCAGCGGGAAGGACTTGAGGGGG - Intergenic
1123580548 15:21711559-21711581 GCAGAGGGAAGGAACTGAAGAGG - Intergenic
1123617196 15:22154182-22154204 GCAGAGGGAAGGAACTGAAGAGG - Intergenic
1124654693 15:31498887-31498909 GGAGAGGGAAGGGCTTGAGGTGG - Intronic
1124685406 15:31777763-31777785 GCTGAGTGAGGGAGTTCTGGGGG + Intronic
1125137193 15:36357532-36357554 GGAGAGTGGAGGAGGGGAGGAGG - Intergenic
1125311603 15:38385157-38385179 CAACAGTGAAGGCGTTGAGGTGG + Intergenic
1125677296 15:41509263-41509285 TGGGAGTGAAGGAGGTGAGGAGG + Intronic
1126130384 15:45335305-45335327 GTACAGTGAAGGAGTTGAGTAGG + Intergenic
1126464777 15:48951648-48951670 GCAAAGTGAAGGCATGGAGGTGG - Intronic
1126538508 15:49795559-49795581 GCAGAGTCACGGAGTGGAAGAGG + Intergenic
1129411798 15:75354509-75354531 GCAGAGTGCAGGGGAGGAGGCGG - Intronic
1129674870 15:77627053-77627075 GCAGAGGGAAGTAGAGGAGGTGG + Intronic
1130976745 15:88782362-88782384 GAGGAGTGCAGGAGTTCAGGGGG + Intergenic
1131039943 15:89255095-89255117 GCAGAGTGTAGGAAATCAGGGGG - Intronic
1132320468 15:100921030-100921052 GCAGAGTGAGGGATGTGAGAGGG - Intronic
1202989418 15_KI270727v1_random:445804-445826 GCAGAGGGAAGGAACTGAAGAGG - Intergenic
1134625018 16:15717356-15717378 GGAGAGTGAAGGCCATGAGGCGG + Intronic
1136054582 16:27678907-27678929 GGAGAGAGAAGGACTTGATGGGG + Intronic
1136187672 16:28597580-28597602 GCAGAGTGAAGGGGCAGGGGTGG + Intergenic
1136190151 16:28610560-28610582 GCAGAGTGAAGGGGCAGGGGTGG + Intronic
1136248187 16:28986840-28986862 GCTGAGTGCAGGAGCTGATGGGG - Exonic
1136296818 16:29308704-29308726 GCAGAGGGCATGAGCTGAGGGGG - Intergenic
1136296847 16:29308810-29308832 GCAGAGGGCACGAGCTGAGGGGG - Intergenic
1136296867 16:29308875-29308897 GCAGAGGGCATGAGCTGAGGGGG - Intergenic
1136296951 16:29309206-29309228 GCAGAGGGCACGAGCTGAGGGGG - Intergenic
1136316755 16:29459055-29459077 GCAGAGTGAAGGGGCAGAAGTGG - Intergenic
1136431330 16:30198397-30198419 GCAGAGTGAAGGGGCAGAAGTGG - Intronic
1136478059 16:30525539-30525561 CCTGAGTGAAGGAGTCCAGGGGG + Exonic
1136748383 16:32612323-32612345 ACAGATTGAAGGAGATGAGCAGG - Intergenic
1137783879 16:51121677-51121699 GCAGAGTGAAGCAGATGCGAGGG - Intergenic
1137798410 16:51240883-51240905 GCAAAGTGAGGGTTTTGAGGGGG - Intergenic
1138027571 16:53534430-53534452 TCAGAGTGAGTGAGTGGAGGGGG + Intergenic
1138150187 16:54649700-54649722 GCAGATGGAGGGAATTGAGGAGG + Intergenic
1138336201 16:56255055-56255077 ACAGAATCAAGGAGTTGAAGAGG - Intronic
1138438776 16:57021869-57021891 GCAGAGTGTGGGAATTGCGGGGG + Intronic
1138441079 16:57035368-57035390 GCAGTGGGAAGGAGTGAAGGGGG - Intronic
1139343402 16:66286657-66286679 GCTGAGTAAAGGTGCTGAGGTGG + Intergenic
1140013028 16:71155094-71155116 GCAGTGTGAAGGAGTGAGGGGGG - Intronic
1141200042 16:81890646-81890668 GCATAGGGAAGGAGGGGAGGTGG + Intronic
1141511389 16:84514420-84514442 CCCGGGTGAAGGAGTTGAGCTGG - Intronic
1141667476 16:85473348-85473370 GCAGGCTGCAGGATTTGAGGGGG + Intergenic
1142040692 16:87891912-87891934 GCAGAGTGGAGGGGTCGAAGGGG + Exonic
1142058441 16:88015050-88015072 GCAGAGGGCATGAGCTGAGGGGG - Intronic
1142058503 16:88015310-88015332 GCAGAGGGCACGAGCTGAGGGGG - Intronic
1142060259 16:88024650-88024672 GCAGAGTGCAGTGGGTGAGGAGG - Intronic
1142165564 16:88585690-88585712 CGAGACTGGAGGAGTTGAGGAGG + Intronic
1142165579 16:88585771-88585793 GCAGATTGCAGGAGATGGGGAGG + Intronic
1203050518 16_KI270728v1_random:871528-871550 ACAGATTGAAGGAGATGAGCAGG - Intergenic
1143092574 17:4457744-4457766 GCAGGGTGCAGGGGGTGAGGGGG - Intronic
1143734018 17:8897725-8897747 ACAGAAAGAAGGAGGTGAGGGGG - Intronic
1144167981 17:12631256-12631278 GGAGAGTGGAGGAGTGGGGGAGG + Intergenic
1144346774 17:14356529-14356551 GCAAACTGAAGGAATTTAGGGGG + Intergenic
1144475856 17:15588795-15588817 GCAGTGTGATTGAGTTGAGTTGG + Exonic
1144937677 17:18913254-18913276 ACAGAGTGAATGAGCTGTGGGGG - Intronic
1146789557 17:35743599-35743621 GGAGGGTGAAGGTGGTGAGGTGG + Intronic
1147350695 17:39840866-39840888 GCAGTGTGAATGAGGTAAGGAGG + Intronic
1147891437 17:43720360-43720382 GCGGAGTCAGTGAGTTGAGGTGG + Intergenic
1148813790 17:50312401-50312423 GCAGAGGGAAGGAGCTGGGAGGG + Intergenic
1148851274 17:50556614-50556636 GCAGAGTGATGGGGCTGACGGGG + Intergenic
1149251286 17:54772653-54772675 GGAGAGTGAAGTAGTTGTGATGG - Intergenic
1149662510 17:58342310-58342332 GCAGATTGAGGGAGGTGAGGAGG + Intergenic
1150727875 17:67666333-67666355 GCAGAGTGCAGGACTTGGTGGGG + Intronic
1151000352 17:70368911-70368933 GCAGAGTGAAGGTGGGGGGGTGG + Intergenic
1152233055 17:79124640-79124662 GCAGAGGGAAGGTGTTGCGGGGG + Intronic
1152795621 17:82304687-82304709 GGAGAGGGAAGGAGATAAGGGGG - Intergenic
1153389387 18:4536834-4536856 GGAGAGTGAAGGAGATTAGAAGG + Intergenic
1154957847 18:21276787-21276809 GAAGAGAGAGGGAGATGAGGTGG + Intronic
1155404497 18:25473050-25473072 GCAGAATGGAGGAGTGGAGATGG - Intergenic
1155453369 18:25986149-25986171 GCATACTGAAGGACTTGAAGAGG - Intergenic
1155794691 18:30021787-30021809 GAACAATGAAGGGGTTGAGGAGG - Intergenic
1156048769 18:32906987-32907009 GCAGGGTTAGGGAGTTGTGGTGG - Intergenic
1157485381 18:48083539-48083561 ACAGAGAGAAGGACTAGAGGAGG + Intronic
1158252114 18:55500335-55500357 GCAGGGGAAAGGAGTGGAGGAGG + Intronic
1160256540 18:77252020-77252042 ACAGGGTGAAGTGGTTGAGGCGG + Intronic
1161108172 19:2454918-2454940 GCAGACTGAAGGAGAAGAGGCGG - Intronic
1161451758 19:4350259-4350281 GGAGAGAGAAGGAGGTGGGGAGG + Intronic
1161815686 19:6498535-6498557 GCAGAGTGAGGGAGGGGATGGGG - Intronic
1162706338 19:12557782-12557804 GCAGAGAGAAGGAAGTGAGGAGG + Intronic
1162801441 19:13112887-13112909 TGTGAGTGAAGGAGGTGAGGTGG - Exonic
1162934612 19:13975482-13975504 ACAAAGAGAGGGAGTTGAGGGGG + Intronic
1162955083 19:14092899-14092921 GGAGGGTGAAGGGGATGAGGGGG + Exonic
1162969918 19:14174395-14174417 GCAGAGAGGAGGAGATGATGAGG + Intronic
1163197569 19:15733860-15733882 GCAGAGGAGAGGAGATGAGGAGG + Intergenic
1165059563 19:33198489-33198511 GCAGAGTCATGGAGCTGTGGTGG - Intronic
1165214235 19:34258360-34258382 GCAGAGGTAAGGAAATGAGGTGG - Intronic
1165860787 19:38908157-38908179 GCAGAGGGAAGGGGTGGAGGAGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
1167473031 19:49685937-49685959 GCAGAGTGAAGGAGGAGCCGAGG + Intronic
1167802657 19:51754883-51754905 GCAGAGCCAAGGAGTTGTGATGG - Intronic
1167898733 19:52602160-52602182 TCAGAGTGAGGGAGAGGAGGAGG + Intronic
1167903163 19:52637399-52637421 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167904557 19:52648020-52648042 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167913848 19:52724796-52724818 CCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167921352 19:52785792-52785814 CCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167925859 19:52820650-52820672 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167930045 19:52856639-52856661 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167934180 19:52892871-52892893 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167940356 19:52941694-52941716 TCAGAGTGAGGGAGAGGAGGAGG - Intronic
1167946373 19:52992361-52992383 TCAGAGTGAGGGAGAGGAGGAGG - Intergenic
1167995210 19:53396115-53396137 TCAGAGTGAGGGAGAGGAGGAGG + Intronic
1168266306 19:55225474-55225496 GGAGAGGGTAGGAGATGAGGAGG + Intergenic
1168312032 19:55465216-55465238 GCAGAGTGAGGGAGGAGAGGGGG + Intergenic
1168451448 19:56469580-56469602 GCAGACTGAAGGAAGTGAGGTGG - Intronic
925122504 2:1430333-1430355 ACAGAATGCAGGAGTTAAGGAGG + Intronic
925139011 2:1537327-1537349 ACAGAGTGGAGGATTTGGGGAGG - Intronic
925331277 2:3060627-3060649 GCAGACAGAGGGAGGTGAGGGGG + Intergenic
925611410 2:5705902-5705924 CCAGGGTAGAGGAGTTGAGGAGG + Intergenic
925611469 2:5706059-5706081 CCAGGGTGGAGGAGTTGAGGAGG + Intergenic
925611517 2:5706214-5706236 CCAGGGTGGAGGAGTTGAGGAGG + Intergenic
926146298 2:10398908-10398930 GGAGAATGAAGGAGTGGAAGTGG - Intronic
926166000 2:10522446-10522468 GCAGAGTGGGGGAGCTGAGCAGG - Intergenic
926198415 2:10777138-10777160 GCAGAGTGCAGGAGATGAGTTGG - Intronic
926371663 2:12184884-12184906 GCAGAGCAAAGGCCTTGAGGCGG + Intergenic
926407080 2:12565551-12565573 GCAGTATGAATGAGTGGAGGTGG + Intergenic
927076936 2:19588266-19588288 GCAAAGTGAAGGAGTAGAGAGGG + Intergenic
928424719 2:31168526-31168548 TAAGGGTGAAGGAGTGGAGGGGG + Intergenic
929243112 2:39672951-39672973 GAACATTGAAGGAATTGAGGTGG + Intronic
929254552 2:39795713-39795735 AGAGAGTGATGGAGTTGTGGGGG + Intergenic
929839212 2:45439424-45439446 GCACAAAGAAGGAGGTGAGGTGG + Intronic
930088286 2:47513921-47513943 TCAGAATGCAGGAGTGGAGGAGG - Intronic
931035268 2:58234484-58234506 TCAGAGAAAAGGAGTTGAAGTGG + Intronic
931476019 2:62588358-62588380 GGAAAGAGAAGGAGATGAGGAGG + Intergenic
931784526 2:65607490-65607512 GGAGAGGGAAGGGGATGAGGAGG + Intergenic
932137241 2:69242186-69242208 GCAGAGGGATGGAGATGGGGTGG - Intronic
933238619 2:79894335-79894357 ACAGAGGGAAGGAGTTGGTGGGG - Intronic
933608158 2:84406100-84406122 ACAGAGAGAAAGAGGTGAGGAGG - Intergenic
934004387 2:87747899-87747921 GCAGCGTGGAGCAGCTGAGGGGG + Intergenic
935477438 2:103540555-103540577 GCAGAGTGGAGGACTAGGGGAGG - Intergenic
935767345 2:106381918-106381940 GCAGCGTGGAGCAGCTGAGGCGG + Intergenic
935844838 2:107154404-107154426 GCAGAGAGAGGGAGTTGAGAGGG + Intergenic
936224898 2:110640076-110640098 ACAGAATGAAGGACTTGAGAGGG - Intronic
936270070 2:111042543-111042565 GCAGAGTGAAGGGCTTGAACAGG + Intronic
936732919 2:115405652-115405674 GCAGAATGCAAGAGTGGAGGAGG - Intronic
937326176 2:120990552-120990574 GCAGGGTCAAGGAGTTTCGGGGG - Exonic
937518392 2:122681849-122681871 GCAGAGTAAATGACTTCAGGTGG + Intergenic
937538320 2:122918381-122918403 GCTGATGGAAGGAGTTGCGGTGG + Intergenic
938144402 2:128821715-128821737 GCAGAGGAAAGGAGATGGGGTGG + Intergenic
939117319 2:138075317-138075339 GCAGTGTGAAAGAATTAAGGTGG + Intergenic
939628668 2:144509543-144509565 GCAGAGTGAATGATTTGAAACGG - Intronic
940185973 2:150985418-150985440 GCAGAGGGATGGAGTGGTGGAGG - Intergenic
943277153 2:185882154-185882176 ACAGAGTGAAGAATTTCAGGAGG + Intergenic
943427216 2:187751793-187751815 GCAGAGAGAAGGAGGTGAGGGGG - Intergenic
943771329 2:191720985-191721007 GCTGGGTGAGGGAGTGGAGGGGG - Intergenic
944293865 2:198040181-198040203 GCATAGACGAGGAGTTGAGGAGG + Intronic
946432518 2:219633242-219633264 GCAGGGTGAGGCAGGTGAGGAGG - Intronic
946774651 2:223124943-223124965 CCAGAGCGAAGGAGCTGAGATGG + Intronic
947498529 2:230656255-230656277 CCAGAATGGGGGAGTTGAGGAGG + Intergenic
947625355 2:231615049-231615071 GCGGGGTGAGGGAGTTGTGGGGG + Intergenic
947706696 2:232282091-232282113 ACAGAGAGTAGGAGGTGAGGAGG - Intronic
948075682 2:235163671-235163693 GCAGAGTGACCCAGTGGAGGAGG + Intergenic
948412338 2:237773850-237773872 GCAGAGTGAAGGTGTCCAGCAGG + Intronic
948562586 2:238864490-238864512 GCAGAGTGCAGGGTTGGAGGCGG + Intronic
1168845305 20:940398-940420 GCAGAGGGTGGGAGGTGAGGAGG + Intergenic
1168956245 20:1836461-1836483 GCAGAGTGAAGGAGGTGGAGAGG - Intergenic
1170178698 20:13503091-13503113 GCACAATTAAGTAGTTGAGGAGG + Intronic
1170834918 20:19875940-19875962 GCAGAGTGACTGATGTGAGGAGG + Intergenic
1170879892 20:20287622-20287644 ACAGAATGAAACAGTTGAGGGGG + Intronic
1171174842 20:23043940-23043962 GCATAGTGAACAAGGTGAGGTGG - Intergenic
1171278605 20:23878834-23878856 GCAGAGTGAAGGAGGTGGTTGGG - Intronic
1172026913 20:31954826-31954848 GAAGTGTGGAGGAGATGAGGGGG + Intergenic
1172175182 20:32967900-32967922 GCTGGGTGATGGAGTTCAGGTGG - Intergenic
1172292159 20:33784193-33784215 GGAGAGGGAGGGAGGTGAGGAGG - Intronic
1172306217 20:33882579-33882601 GCAGAGACAAGGAGGTGGGGTGG - Intergenic
1172908017 20:38383866-38383888 AGTGAGTGAAGGAGCTGAGGAGG - Intergenic
1173659424 20:44723105-44723127 GCAGAGAGCAGGAGGAGAGGAGG - Intronic
1175602639 20:60287468-60287490 AGAGAGTGAAGAAGTGGAGGTGG + Intergenic
1176125046 20:63471549-63471571 GCTGAGCGCAGGAGCTGAGGGGG + Intronic
1177536623 21:22436589-22436611 GAAGTGTGAAGGAGTTGAGGAGG - Intergenic
1178341980 21:31793490-31793512 GAAGAGTGAAGCAGATAAGGAGG + Intergenic
1178354295 21:31897759-31897781 GGACAGTGAAGGAGGTGGGGTGG + Intronic
1178385024 21:32142071-32142093 GCAGAGTTTTGGAGTTGATGTGG - Intergenic
1179224279 21:39439782-39439804 GCAGAGTGAAGTAGTTGTAAGGG + Intronic
1179975173 21:44861394-44861416 GCAGAGATGAGGCGTTGAGGGGG - Intronic
1180760264 22:18196990-18197012 GCTGAGTGAAGGACCTGAGATGG + Intergenic
1180770576 22:18381288-18381310 GCTGAGTGAAGGACCTGAGATGG + Intergenic
1180775405 22:18427706-18427728 GCTGAGTGAAGGACCTGAGATGG - Intergenic
1180808474 22:18738761-18738783 GCTGAGTGAAGGACCTGAGATGG - Intergenic
1180825150 22:18856545-18856567 GCAGAGAAAAGGCGTTCAGGTGG - Intronic
1180828519 22:18884246-18884268 GCTGAGTGAAGGACCTGAGATGG + Intergenic
1181050218 22:20234769-20234791 GCAGAGAGAAAGAGTGGAGGCGG - Intergenic
1181071404 22:20343725-20343747 GCTGAGTGAAGGACCTGAGATGG - Intergenic
1181194476 22:21172675-21172697 GCTGAGTGAAGGACCTGAGATGG - Intergenic
1181214966 22:21320103-21320125 GCTGAGTGAAGGACCTGAGATGG + Intergenic
1181876322 22:25943542-25943564 GCACAGAGAAGGAGAGGAGGAGG - Intronic
1182437803 22:30341787-30341809 GGAGAGTGAGGAAGTTGAGATGG - Exonic
1182582108 22:31320356-31320378 CCAGGATGAAGGAATTGAGGGGG + Intergenic
1182827247 22:33276412-33276434 GCAGAGTTAAGTAGTTGAAAAGG + Intronic
1183014458 22:34974369-34974391 GCACATAGAAGGTGTTGAGGTGG - Intergenic
1183065833 22:35362091-35362113 GCAGAGTGAGGTAGTGGAGGTGG + Intergenic
1183361694 22:37386312-37386334 GCAGAGTGAGGGAGTCCATGGGG - Intronic
1183410724 22:37653754-37653776 GCAGAGGGAAGGAGAGGATGGGG - Intronic
1183492273 22:38122986-38123008 AGAGAGTGGAGGAGTAGAGGAGG - Intronic
1183583763 22:38740384-38740406 GCTCTGTGAAGGAGCTGAGGCGG - Exonic
1183672514 22:39281391-39281413 GCAAAGTGAAGCAGAGGAGGGGG - Intergenic
1183674477 22:39291885-39291907 GGAGAGTGAAGGAGGTGAATTGG + Intergenic
1183934726 22:41255600-41255622 GTAGAGTGGTGGAGTTGGGGAGG - Intronic
1184358114 22:43996056-43996078 GGAACGTGAAGGAGGTGAGGAGG + Intronic
1184510523 22:44930640-44930662 GGACAGTGAAGGAGGAGAGGAGG + Intronic
1203215333 22_KI270731v1_random:2941-2963 GCAGAGAAAAGGCGTTCAGGTGG + Intergenic
1203232411 22_KI270731v1_random:122460-122482 GCTGAGTGAAGGACCTGAGATGG + Intergenic
1203278613 22_KI270734v1_random:110235-110257 GCTGAGTGAAGGACCTGAGATGG + Intergenic
951078674 3:18425717-18425739 GCAGAGGGGAGGAGGAGAGGGGG + Intronic
952412413 3:33061475-33061497 GCAGAGTTGAGTAGTTGAGATGG - Intronic
952724932 3:36573777-36573799 GCAGAGTGCATGAGCTGTGGGGG - Intergenic
953126503 3:40095891-40095913 GGAGAGGGAAGGTGCTGAGGTGG - Intronic
953184449 3:40625201-40625223 GCAAAGAGAAGGAAGTGAGGTGG + Intergenic
953479720 3:43240640-43240662 TGAGAGTGAAGGAGGGGAGGAGG - Intergenic
953660008 3:44884949-44884971 GCAGAGAGGGGGAGTTGGGGTGG + Intronic
955037272 3:55281293-55281315 GCAGAATGAAGGAATAGAAGGGG + Intergenic
958478563 3:94617178-94617200 GCTGATTGTAGGAGGTGAGGAGG + Intergenic
959310506 3:104729825-104729847 GCAGAGTGCAAGAGTTGTGGGGG - Intergenic
959658196 3:108834343-108834365 GCAGAGAGAAAGGGTGGAGGTGG - Intronic
960231656 3:115235107-115235129 GAAGAGGGAAGGATTTTAGGAGG + Intergenic
960294684 3:115928670-115928692 GCAGAGTGCAGGGGGTGAGGAGG + Intronic
961153269 3:124657824-124657846 GCCTAGTGAAGGAGTTGGGGAGG - Intronic
961517380 3:127446365-127446387 CCAGAGTGAAGGAGCAGAAGTGG + Intergenic
961664561 3:128487746-128487768 TGAGAGTGAAGGAGTTCCGGCGG + Intronic
961880975 3:130060991-130061013 ATAGAGTGGAGGAGTGGAGGCGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965078921 3:164012869-164012891 GTACAGTGTAGGAGTGGAGGTGG - Intergenic
965849341 3:173004483-173004505 GCTGATTTAAGGAGTTGAGAGGG - Intronic
967439618 3:189491570-189491592 CAAGAGTGAAGGATTAGAGGTGG - Intergenic
967787681 3:193514960-193514982 GCAGAGTGAAGGAGTTGAGGAGG + Intronic
969564544 4:7970343-7970365 GCAGAGGGAAGGTGTCAAGGGGG + Intronic
973711803 4:53637045-53637067 GGAGAGTGAAACAATTGAGGCGG - Intronic
974198715 4:58611293-58611315 GCAGAGTGCAAGAGCTGTGGAGG + Intergenic
974214387 4:58827182-58827204 GTAGAGTGAAAGGGTTGTGGAGG + Intergenic
975411549 4:74057809-74057831 GGAGGGTGAAGGAGTTGAGGGGG + Intergenic
975578861 4:75889297-75889319 GAAGAGTAATGGAGGTGAGGGGG - Intronic
975612418 4:76215158-76215180 GCAGAGCTCAGCAGTTGAGGCGG + Intronic
975647793 4:76562648-76562670 ACAGTGTGAAGGAAGTGAGGAGG - Intronic
978018563 4:103779482-103779504 GAAGAGTGAAGGAGTTTCTGTGG - Intergenic
978070260 4:104458552-104458574 GCAGAGAGATGGAGATGATGAGG - Intergenic
978619975 4:110628359-110628381 GCAGGGAGAAGGACTGGAGGTGG + Intronic
981048580 4:140289431-140289453 TCACAGTGAAGGAAATGAGGGGG - Intronic
981110060 4:140925091-140925113 GCAAAGTGGAGGGGCTGAGGGGG + Intronic
984845598 4:184105601-184105623 GCAGAGAGAGTGAATTGAGGAGG + Intronic
984862355 4:184252290-184252312 GAAGAGGGAAGGAGAAGAGGAGG + Intergenic
985424384 4:189814123-189814145 CCAGAGTGAAGGAAATGAGAAGG + Intergenic
985781388 5:1873711-1873733 GCAGAGGGAAGAAGTGGGGGAGG - Intergenic
986728479 5:10617741-10617763 GCAGAGTGAGTGAGAAGAGGAGG - Intronic
989249479 5:39293015-39293037 GGAGAGTGCTGGAGTTCAGGGGG + Intronic
990879128 5:60520418-60520440 GCTGAGAGAAGGATTTGGGGAGG - Intronic
991052389 5:62287229-62287251 GCAGAGGGAAGTAGGTGTGGGGG + Intergenic
991187639 5:63828895-63828917 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
993042869 5:82835497-82835519 GCAGAATGCAGGAGTGGTGGTGG - Intergenic
993378899 5:87183169-87183191 TCAGAGTAAAGGGGATGAGGAGG + Intergenic
994309129 5:98246113-98246135 GAAGTGTGAAGGAGTAGAAGTGG - Intergenic
994355724 5:98792202-98792224 ACAGAGAGAAAGAGTTGAGGAGG - Intronic
996920744 5:128765044-128765066 GCAGACAGAAGGAGTTCGGGGGG + Intronic
998236633 5:140403263-140403285 GCAGAGTGAAGGTGTCCAGCCGG - Intronic
998822184 5:146067095-146067117 GAAGGGTGGAGGAGGTGAGGCGG - Intronic
999112821 5:149136967-149136989 GCAGAAGGAAGGAGCTGAGGTGG - Intergenic
999387942 5:151168732-151168754 GCAGAATGGAAGAGTTGGGGCGG - Intergenic
999408484 5:151328122-151328144 GCAGAGTGCAGCAGTTGAGCAGG - Intronic
999499484 5:152132410-152132432 GCAGAGTGCAGGGGCTGTGGAGG - Intergenic
1000323099 5:160150517-160150539 GCAGAGGGAAGGAGTTTGGCAGG + Intergenic
1000441857 5:161272757-161272779 GGAAAGTCAAGGAGTTGAGTTGG + Intergenic
1000874575 5:166620119-166620141 GGAAAGTGAAGGGGTTGAGTAGG + Intergenic
1001133009 5:169079894-169079916 GAAGAGTGAAGAAGAAGAGGAGG + Intronic
1001143086 5:169161482-169161504 TCAGGCTGAAGGAGTGGAGGCGG - Intronic
1001272711 5:170327646-170327668 GCAGAGAGAAGGTGTTAGGGTGG - Intergenic
1001990257 5:176110711-176110733 ACAGATTGAAGGAGATGAGCAGG - Intronic
1002226615 5:177727429-177727451 ACAGATTGAAGGAGATGAGCAGG + Intronic
1002267228 5:178043784-178043806 ACAGATTGAAGGAGATGAGCAGG - Intronic
1002777560 6:341829-341851 GGCGTGTGAAGGAGCTGAGGAGG - Intronic
1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG + Intergenic
1002950424 6:1804439-1804461 GCAGAGAGGAGAAGTGGAGGTGG - Intronic
1003829472 6:9991562-9991584 ACAGAGTGAAGTATTTGAGCTGG + Intronic
1005722118 6:28613535-28613557 GCAGAGAGAAGGAAGTGAGGAGG - Intronic
1005726294 6:28652038-28652060 GTGTAGTGAATGAGTTGAGGTGG + Intergenic
1006079837 6:31558775-31558797 GCAGAGTCAAGGAGCAGTGGTGG - Exonic
1006106293 6:31718920-31718942 GGAGAGTGAAGGGTGTGAGGTGG + Exonic
1006163106 6:32049432-32049454 GCACGGTGAAGGAGTCGAAGCGG + Intronic
1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG + Intronic
1006164362 6:32056013-32056035 GCACGGTGAAGGAGTCGAAGTGG + Intronic
1006165359 6:32061559-32061581 GCACGGTGAAGGAGTCGAAGCGG + Intronic
1006166317 6:32067823-32067845 GCACGGTGAAGGAGTCGAAGCGG + Intronic
1006743630 6:36326215-36326237 CCAGGGTGCAGAAGTTGAGGCGG + Intronic
1007622593 6:43224065-43224087 GCAGACAGAAGGATTTGAGAAGG - Intronic
1009930604 6:70173197-70173219 GCAAAGTGAAGGTATTGAGTAGG + Intronic
1010589097 6:77692056-77692078 GGAGAGTGTATGAGATGAGGTGG - Intronic
1011124140 6:83987975-83987997 GCAGAGTGCAGGAGTAGGTGGGG + Intergenic
1012246959 6:96936987-96937009 TGAGAGTGAAGGGGTTGGGGTGG - Intronic
1013409650 6:109872757-109872779 GCAGAGTGAGGGGGAGGAGGAGG - Intergenic
1013900047 6:115144232-115144254 GCAGGGTTTAGGAGTTGAGAAGG - Intergenic
1014214393 6:118738737-118738759 AGAGAGTGCAGGAGTGGAGGAGG - Intergenic
1014613117 6:123568561-123568583 GCAGAGTGCAAGAGTTAAAGAGG - Intronic
1014798418 6:125750096-125750118 GCAGAGCGCAGGAGTTGGCGAGG + Intronic
1015090212 6:129347031-129347053 ACAGAGTGAATGAGAAGAGGGGG + Intronic
1015885069 6:137909583-137909605 AAAGAGGGAAGGAGTAGAGGGGG + Intergenic
1017999091 6:159562864-159562886 GCAGTGTGAATGAGTTCTGGAGG + Intergenic
1018374068 6:163194862-163194884 GGAGAGTGAAGGAGGTGGGAAGG - Intronic
1019089715 6:169518396-169518418 GCAGAGTGCAAGAGTGAAGGAGG - Intronic
1019183015 6:170204093-170204115 GCAGAGTGAAGGAGGGGAAAAGG - Intergenic
1019929579 7:4214853-4214875 GCAGACTGACGGTGTTGTGGCGG - Intronic
1020951962 7:14690657-14690679 GCAGAGTTTAGCAGTTAAGGCGG + Intronic
1021592622 7:22280329-22280351 GCACAGTGAAGCAGAGGAGGAGG + Intronic
1024213795 7:47229010-47229032 CATGAGTTAAGGAGTTGAGGAGG - Intergenic
1025888899 7:65627054-65627076 ATAGAGTGGAGGAGTTGAAGAGG + Intergenic
1027123090 7:75536327-75536349 GCACAGAGAGGGAGTTGGGGAGG + Exonic
1027219536 7:76205056-76205078 GCTCAGTGAAGGAGTTGCGGAGG - Intronic
1027540036 7:79454242-79454264 GCCGTGAGAAGGAGTTGGGGCGG + Intergenic
1028033920 7:85955136-85955158 GGATAGGGAAGGAGTTTAGGAGG + Intergenic
1028379891 7:90188351-90188373 GCTAAGTGAAGGAGTTTACGAGG + Intronic
1030464138 7:109878348-109878370 GGAGAGAGAAGGGGTTGAGGGGG - Intergenic
1030834513 7:114265763-114265785 ACAGAGTGCAAGAGTTAAGGAGG - Intronic
1031715141 7:125099626-125099648 GCAGTGGGCAGGAGTGGAGGAGG + Intergenic
1031853550 7:126894914-126894936 ATAGAGTGGAGGAGTTGAAGAGG - Intronic
1032404318 7:131644716-131644738 CCAGAGAGAAGGAGGTGAGAAGG - Intergenic
1032552577 7:132798641-132798663 GCAGGGGGAAGGAGGTGAGGAGG + Intronic
1034155380 7:148952073-148952095 GAAGACTGGAGGAGGTGAGGAGG + Intergenic
1034471179 7:151255168-151255190 TCAAAGTGCAGGAGTTGAGGGGG - Intronic
1034829063 7:154293504-154293526 CCAGGATGAAGGAGTTGATGGGG - Intronic
1036033155 8:4993782-4993804 GGAGAGGGAAGGAGGAGAGGAGG + Intronic
1037916654 8:22777232-22777254 GGGGAGTGGAGGAGTAGAGGAGG - Intronic
1038075866 8:24072814-24072836 GCAGATGGAAGGAGCTGATGGGG + Intergenic
1038209204 8:25499699-25499721 ACACAGTGAAGGAGGTCAGGAGG - Intronic
1038399723 8:27274361-27274383 GCATAGCGAAAGAGTTGAGGAGG + Intergenic
1038442338 8:27580057-27580079 GGAGAGTGCAGGAGTGGAGGTGG - Intergenic
1039109977 8:34031336-34031358 GCAGAGAGAAGGCCCTGAGGTGG + Intergenic
1039539116 8:38348095-38348117 GCGGAGTCAATGAGTTGAGGTGG + Exonic
1041408266 8:57525774-57525796 GCAGAGTGAAGGGATGGAGGTGG - Intergenic
1043609274 8:82042173-82042195 GCAGAAAGAAGGCTTTGAGGAGG - Intergenic
1043785426 8:84392589-84392611 TCAGCCTGAAGGAGTTGGGGAGG + Intronic
1043958817 8:86391674-86391696 GGAGAATGAAGGAGTGGGGGTGG + Intronic
1044489926 8:92801340-92801362 GCAGAGTTGAGGAGTTGAGATGG - Intergenic
1044720485 8:95140753-95140775 CCAGGGCCAAGGAGTTGAGGTGG - Intronic
1044869125 8:96601279-96601301 GCAGAGTGGAGAAGATGATGAGG + Intronic
1045248457 8:100463487-100463509 CCAGAGTGAAGGACATGGGGTGG - Intergenic
1045357927 8:101405751-101405773 GAAGAGGGAAGGAGTGAAGGAGG - Intergenic
1045622675 8:104000188-104000210 GTAGAGAGAAGGAGATGAAGAGG - Intronic
1045663097 8:104458330-104458352 GTGGAGTGAATGAGTTGAGAGGG - Intronic
1046679629 8:117154250-117154272 GCAGAGTGTGGGGGTTGTGGGGG - Intronic
1047033918 8:120914023-120914045 GGAGATGGAAGGAGTTGAGAAGG + Intergenic
1047054896 8:121153041-121153063 ACAGTGTGAAGGAGAGGAGGAGG - Intergenic
1047374266 8:124281327-124281349 GCAGAGCGAAGGTGGTGGGGCGG + Intergenic
1047684473 8:127290863-127290885 GCAGAGTGTAGGAGGATAGGTGG - Intergenic
1048096456 8:131300568-131300590 GCAGAGTGCATGAATTAAGGAGG - Intergenic
1048204806 8:132406938-132406960 GGAAAGTGAAGAAGTGGAGGGGG + Intronic
1049444845 8:142625141-142625163 ACAGAGAGAAGGAGGTGAGATGG + Intergenic
1049588091 8:143441123-143441145 GCAGAGAGAAGGGGTGCAGGTGG + Intronic
1049653084 8:143784715-143784737 CCAGAGGGAAAGAGCTGAGGAGG + Intergenic
1050058424 9:1679495-1679517 GCAGATTCAGGGAGTTTAGGGGG + Intergenic
1050070134 9:1801774-1801796 GAAGAGTGGAGGATTTGAGTAGG + Intergenic
1052031183 9:23630651-23630673 GAAGACTGAAGGAGTGGAGGAGG + Intergenic
1054922582 9:70556734-70556756 GCAGAGTCAGGGTTTTGAGGGGG - Intronic
1055030127 9:71765827-71765849 GTAAAGAGAAGGAGTTGAAGTGG - Intronic
1055552802 9:77446617-77446639 GGAGAGTGAAGGAGAAGGGGTGG + Intronic
1055813412 9:80178025-80178047 GCAGAGTGCAAGAGTGAAGGAGG - Intergenic
1056701498 9:88914915-88914937 GCAGAGGGCAGAAGTTGAGGAGG - Intergenic
1057865560 9:98677691-98677713 GCAGAGTGATGGAGTGGGGCAGG - Intronic
1057890217 9:98864320-98864342 GAGGATTGAAGGAGGTGAGGGGG + Intergenic
1058541095 9:106013561-106013583 CCAGAGTGATGGATTTGGGGAGG - Intergenic
1058572804 9:106365737-106365759 GCAGAGTGCAGAAGCTGAGGAGG - Intergenic
1058597450 9:106630196-106630218 GCAGAGTGCAGAAGGTGGGGTGG + Intergenic
1059100262 9:111464775-111464797 GGAGAGGGAAGGAGGGGAGGAGG + Intronic
1059507498 9:114813185-114813207 GGAGAGTGAAGGCGGTGATGAGG + Intergenic
1059522058 9:114951994-114952016 GCTGAGTGTTGGAGTTGAGGAGG - Intergenic
1059735174 9:117093255-117093277 GCAGAGTGAAGTTGCTGAGAAGG - Intronic
1060668374 9:125447228-125447250 GAAGAGTGAAGCAGGTGAGGAGG + Intronic
1061000345 9:127899198-127899220 CCGGAGTGCAGGAGTTGGGGAGG - Intronic
1061649860 9:132038805-132038827 GAAGAAGGAAGGAGCTGAGGTGG + Intronic
1061938193 9:133870257-133870279 GCAGAGTGCAGGAAGAGAGGTGG + Intronic
1062412850 9:136433566-136433588 TCTGGGGGAAGGAGTTGAGGTGG - Intronic
1062615420 9:137393919-137393941 GCAGGGTGAAGGATGTGAAGGGG + Intronic
1186200855 X:7153645-7153667 AGAGAGGGAGGGAGTTGAGGAGG - Intergenic
1186200873 X:7153725-7153747 AGAGAGGGAAGGAGTCGAGGAGG - Intergenic
1186200889 X:7153802-7153824 AGAGAGGGAGGGAGTTGAGGAGG - Intergenic
1187562367 X:20414827-20414849 GCAGAATGAAACAGCTGAGGAGG + Intergenic
1189070426 X:37857390-37857412 GCAGAGTGCAAGAGTTAAGGAGG - Intronic
1189083611 X:37997969-37997991 GCAGAGAGGAGGACTTGGGGTGG - Intronic
1189348268 X:40258845-40258867 GTGGATTAAAGGAGTTGAGGTGG - Intergenic
1190552641 X:51600305-51600327 GAAGAGTGGAGGGGTTGAAGAGG + Intergenic
1191767132 X:64710162-64710184 GCAGAGTGAAGCAGCAGAGAAGG - Intergenic
1192142617 X:68658788-68658810 CCAGAGGGATGGAGTTGAGGAGG - Intronic
1192815915 X:74591975-74591997 GCAGAGTCACGGAGTGGAAGAGG - Exonic
1194168892 X:90557327-90557349 GCAGAGTGCAAGAGTAAAGGAGG + Intergenic
1194878407 X:99219303-99219325 GCAGAGTGCAAGAGCTGTGGAGG - Intergenic
1195037825 X:100986179-100986201 GAAGAGTCAAGGGGTGGAGGTGG - Intronic
1196626614 X:117884456-117884478 GCACAGTGGAGGAGCTGACGGGG + Intergenic
1197762239 X:130036120-130036142 GCTGGGTGAATGAGGTGAGGAGG - Intronic
1197868536 X:131044074-131044096 GCAGTTTGAAGCAGTTGAGAAGG - Intergenic
1198270371 X:135051396-135051418 GCAGTCTGGAGGAGTGGAGGTGG + Exonic
1198640011 X:138746260-138746282 GCAGAGTGGAGAATATGAGGGGG + Intronic
1200047798 X:153411762-153411784 GCAGGGTGCAGGTGTCGAGGGGG + Intergenic
1200091281 X:153637282-153637304 GCAGAGAGAAGGTGGAGAGGAGG - Intergenic
1200142776 X:153910098-153910120 GCAGAGCGAGGCAGATGAGGGGG + Intronic
1200515135 Y:4135112-4135134 GCAGAGTGCAAGAGTAAAGGAGG + Intergenic