ID: 967791470

View in Genome Browser
Species Human (GRCh38)
Location 3:193553577-193553599
Sequence TCCACAAATGTCACCAGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967791470_967791475 0 Left 967791470 3:193553577-193553599 CCATTTCTGGTGACATTTGTGGA 0: 1
1: 0
2: 2
3: 25
4: 241
Right 967791475 3:193553600-193553622 GGGGCTGAAGGCAATTCATTTGG 0: 1
1: 0
2: 0
3: 11
4: 114
967791470_967791476 25 Left 967791470 3:193553577-193553599 CCATTTCTGGTGACATTTGTGGA 0: 1
1: 0
2: 2
3: 25
4: 241
Right 967791476 3:193553625-193553647 GTCAAATCTGAATGAAGTAAAGG 0: 1
1: 0
2: 3
3: 21
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967791470 Original CRISPR TCCACAAATGTCACCAGAAA TGG (reversed) Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902631127 1:17705399-17705421 TCCTCAAAATTAACCAGAAAGGG + Intergenic
903247313 1:22025553-22025575 CCCACAAATGACTCCAGGAAAGG - Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906086082 1:43135793-43135815 CCCAGAAGTGTTACCAGAAAGGG + Intergenic
906877443 1:49554639-49554661 CCCACAAATGTGTCCAGAATTGG + Intronic
907402893 1:54235921-54235943 TCAAAAAATGTCACCAGAAAAGG - Intronic
907418300 1:54329624-54329646 TCTGCAAGGGTCACCAGAAAAGG + Intronic
907485320 1:54774087-54774109 TCCTCACATGGCAGCAGAAATGG + Intergenic
907536073 1:55158954-55158976 TCCACAATTGTCACCAGATCCGG + Exonic
908395222 1:63719214-63719236 TGGAGAGATGTCACCAGAAAGGG - Intergenic
908564405 1:65339878-65339900 TCCACCAATGTCACCATTAGTGG + Intronic
908564871 1:65344141-65344163 TGCAGAAATGGCACCACAAATGG - Intronic
909802544 1:79829950-79829972 TCTACAAATATCAAAAGAAATGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913349655 1:117843116-117843138 TTCACACATGTCAGCAGTAATGG - Intergenic
915401159 1:155622821-155622843 TACAGAATTGTCACCAAAAAAGG - Intergenic
915887692 1:159740805-159740827 TCCTCACATGGCAGCAGAAATGG + Intergenic
915926163 1:160021303-160021325 TTGCCAAATGTCCCCAGAAAGGG + Intergenic
916085692 1:161267506-161267528 GCAACCACTGTCACCAGAAAAGG - Intronic
916424977 1:164671650-164671672 TACACACATGTTCCCAGAAATGG - Intronic
916828870 1:168470661-168470683 TCCACAAATGTTTGCTGAAATGG - Intergenic
919467897 1:197944514-197944536 TCCCTAAATGTCCCCAGAGAAGG + Intergenic
922487519 1:225986804-225986826 TCCAATAGTCTCACCAGAAAGGG + Intronic
922815108 1:228443285-228443307 GACACAAATGTTACCCGAAAGGG - Intergenic
923508106 1:234624196-234624218 TCCACTGAGGTCCCCAGAAAGGG - Intergenic
923811364 1:237320985-237321007 ATCACAAATGTTACCACAAATGG + Intronic
923857356 1:237859368-237859390 TCCACACATGTCCACAGAGAGGG + Intergenic
1063401422 10:5749533-5749555 TCCACAACTGTTACCAGAAGGGG - Exonic
1065673227 10:28144935-28144957 TTTATAAATGTCACCAGCAACGG - Intronic
1066190192 10:33049112-33049134 TCCTCAAATGCCACCAAAATGGG - Intergenic
1068454827 10:57240470-57240492 TGCAGAATTGTTACCAGAAATGG + Intergenic
1069057531 10:63860269-63860291 TTTACAAATGGGACCAGAAAGGG - Intergenic
1071318974 10:84432933-84432955 TCAACAAATGAGACTAGAAATGG - Intronic
1071518005 10:86311968-86311990 TCCACCAATGTAAACAGAACTGG + Intronic
1072226481 10:93374725-93374747 TACACAAACGTCACCTGATATGG - Intronic
1075738015 10:124675970-124675992 TCCACTAAGTTCACCTGAAAAGG + Intronic
1077348547 11:2077038-2077060 TCCACTCATGTCCTCAGAAACGG + Intergenic
1081621346 11:44620719-44620741 TCCACAAATCTTTGCAGAAACGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1084411862 11:69010221-69010243 TCCAGAACTCTCACAAGAAAAGG - Intronic
1084983128 11:72843404-72843426 CCTAAAAATGTCACAAGAAAGGG + Intronic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089519524 11:119054675-119054697 TCTACAGATGACAACAGAAAAGG + Exonic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1089883518 11:121797347-121797369 AGCACAAATGTTACAAGAAAGGG - Intergenic
1092946211 12:13456745-13456767 ACCAGAGAAGTCACCAGAAAGGG - Intergenic
1093219308 12:16399913-16399935 TCATCCAATGTCACCACAAAAGG + Intronic
1093474206 12:19536868-19536890 TGCAAAAATCTCATCAGAAATGG - Intronic
1093699188 12:22198931-22198953 TTGCCAAATGTCACCAGAGAGGG + Exonic
1093788518 12:23219663-23219685 TCCAGAAATGTCTCCGGAATTGG - Intergenic
1094119692 12:26957753-26957775 TCTATAAATGTGACCTGAAATGG + Intronic
1095405007 12:41858113-41858135 ATCACAAATGTAGCCAGAAAAGG - Intergenic
1097152357 12:56988310-56988332 TCAACAAAAGTTAACAGAAACGG + Intergenic
1098085173 12:66834711-66834733 TCCAAAAAAATCACCATAAAAGG - Intergenic
1102565529 12:113794943-113794965 TGTACATATGTAACCAGAAACGG + Intergenic
1103518054 12:121520295-121520317 TCCACAAGTGTCCCCTGAAAAGG - Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1110539170 13:76688556-76688578 TTCACAGATGTAACCAGAGATGG - Intergenic
1113385374 13:109843211-109843233 TCCACTAAAGTCACTCGAAAGGG + Intergenic
1113666800 13:112147243-112147265 TCCACAAATATCATCATACAGGG - Intergenic
1113666923 13:112147791-112147813 TCCACAAATATCATCATACAGGG - Intergenic
1113667037 13:112148342-112148364 TCCACAAATATCATCATACAGGG - Intergenic
1113667077 13:112148536-112148558 TCCACAAATATCATCATACAGGG - Intergenic
1113667135 13:112148827-112148849 TCCACAAATATCATCATACACGG - Intergenic
1113667170 13:112148987-112149009 TCCACAAATATCATCATACAGGG - Intergenic
1113667209 13:112149181-112149203 TCCACAAATATCATCATACAGGG - Intergenic
1114299013 14:21357341-21357363 TCATCCAATGTCACCACAAAAGG + Exonic
1117552935 14:56853937-56853959 TTCAAAAATGTCAACAGCAAGGG + Intergenic
1118134106 14:63002656-63002678 TCACCTAATGTCACCACAAAGGG + Intronic
1121612577 14:95291707-95291729 TCCTCTAAGATCACCAGAAATGG + Intronic
1122777426 14:104127218-104127240 ACCACAAATGTCTCAGGAAAAGG - Intergenic
1127946970 15:63765208-63765230 TCCACAAATTGCAAGAGAAAAGG - Intronic
1129436162 15:75542305-75542327 CCTACAAATCTCATCAGAAAGGG + Intronic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130972908 15:88748372-88748394 TCCACTCATGTCACCAAATATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133942888 16:10325238-10325260 TCTGGAATTGTCACCAGAAAGGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134829754 16:17313433-17313455 TCCATAAAAGTCAGCAGGAAAGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135910335 16:26554851-26554873 TCCAGAAATGGGAGCAGAAAGGG + Intergenic
1138331614 16:56220019-56220041 CCCAGAAATGTCAACAGAAAGGG + Intronic
1139196421 16:64924049-64924071 TCCCTAAATGTCACCATTAATGG + Intergenic
1141181334 16:81754912-81754934 CCCACAAAGGTCATCAAAAAGGG + Intronic
1141644505 16:85360112-85360134 TCCCCAAAGGTCTCCAAAAAGGG - Intergenic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1144239276 17:13294310-13294332 TCAACAAAAGTCACAAGACAAGG + Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1151838651 17:76601427-76601449 TCCATTACTATCACCAGAAAGGG + Intergenic
1152329223 17:79661887-79661909 GCAACATATGTCACCAAAAAAGG - Intergenic
1153214593 18:2808020-2808042 CACACAAAGGGCACCAGAAAAGG + Intergenic
1155182166 18:23357435-23357457 TCCAAAAATGTCCGGAGAAAAGG + Intronic
1156530355 18:37808949-37808971 TCCACACATTTGGCCAGAAATGG + Intergenic
1156918693 18:42492140-42492162 TCCACAATGGACACCAGGAATGG + Intergenic
1156985842 18:43350644-43350666 TGCACCAATGTCACTTGAAATGG - Intergenic
1156987744 18:43369236-43369258 TCCACAAATGTAAACAGTATTGG - Intergenic
1156987746 18:43369338-43369360 TCCACAAATGTAAACAGTATTGG - Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1159117447 18:64131839-64131861 TCCAGAAGTGTCATCAGAAATGG + Intergenic
1159705350 18:71679348-71679370 TCCACAAATCTCTAGAGAAAGGG - Intergenic
1160802400 19:976459-976481 ACCACAAATGCCCCCAGACATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161725727 19:5927439-5927461 ACCACAAATGTCCCCAGACGTGG - Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163585276 19:18160524-18160546 TCCACAAGCTTCACCAGAAGAGG - Exonic
1167387660 19:49173558-49173580 TCCAGATATTTCACTAGAAATGG + Intronic
925646974 2:6045382-6045404 CCCCCACTTGTCACCAGAAAGGG + Intergenic
926129777 2:10295533-10295555 GCCACTACTGTCACCACAAAGGG + Intergenic
928692520 2:33815501-33815523 ACCACAAATGTTAGCAGTAATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930506325 2:52286358-52286380 ACCACAAAATTGACCAGAAAAGG + Intergenic
934092911 2:88569527-88569549 ACCACCAATCTCACCAGAAAAGG - Intronic
934553992 2:95277921-95277943 TCCACAGAGGGCACCTGAAATGG - Exonic
935262472 2:101367192-101367214 ACAACAGATGGCACCAGAAAAGG + Intronic
935352744 2:102167779-102167801 TCTACAAATGGGATCAGAAAAGG - Intronic
936394820 2:112116957-112116979 TCCACAAAGTTCACCAGTAATGG - Exonic
937502022 2:122489497-122489519 TCCACAGAATCCACCAGAAAAGG - Intergenic
937954237 2:127410895-127410917 AACCAAAATGTCACCAGAAAAGG - Intergenic
938258163 2:129876746-129876768 TCAACAACTGGCACCAGAATCGG + Intergenic
942682206 2:178488959-178488981 TCCAAAGTTGTCACCTGAAAAGG - Intronic
944045852 2:195411175-195411197 TCCACAAGTCTCAGGAGAAAAGG + Intergenic
945034378 2:205691679-205691701 TCCCCAAATGTCTCCTAAAATGG + Intronic
945635747 2:212348118-212348140 TCCAAAAATGTCACAGGAAAAGG + Intronic
946429565 2:219617815-219617837 TACACAATTTTCCCCAGAAAAGG + Intergenic
946845471 2:223855050-223855072 ACCACTAGTGTTACCAGAAAGGG - Intergenic
947250268 2:228095115-228095137 TCCAAAACTGTCAATAGAAATGG + Intronic
948354426 2:237366635-237366657 GGCACAAATGTCAACAGGAAAGG + Intronic
1169844605 20:9976096-9976118 TCCACAAATGTAGCCAGCATAGG - Intergenic
1170207728 20:13817234-13817256 TCCAGAATTTTCATCAGAAATGG + Exonic
1172884479 20:38222161-38222183 TCCAAAAGGGTGACCAGAAATGG + Intronic
1172904313 20:38357542-38357564 TCCCAAAATATTACCAGAAAGGG + Intronic
1173056015 20:39613583-39613605 GCCACAACTGTCACAAGGAAGGG - Intergenic
1173889179 20:46491316-46491338 TCCACAAAAGTTACAGGAAAAGG - Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1176883163 21:14222884-14222906 TCCGCAAATGTTAGCATAAAGGG + Intronic
1178212635 21:30554833-30554855 TCCACAAAAATCAGGAGAAAGGG + Intronic
1178757786 21:35368981-35369003 TTCCCAAATGTGACCTGAAAGGG - Intronic
1179276605 21:39897533-39897555 ACCACACATGTAAACAGAAAGGG - Intronic
1179400801 21:41081224-41081246 CCCACACTTGTTACCAGAAAGGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183207226 22:36427811-36427833 TGAAGAAATGTTACCAGAAAGGG - Intergenic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
950892578 3:16417461-16417483 TACACAAATGTCAACACAACTGG + Intronic
953446443 3:42972701-42972723 TCAAAAACTGTCACCAGGAAAGG + Intronic
954605417 3:51905617-51905639 TCCACAAATCTCTACAGAAGGGG - Intergenic
955297170 3:57746574-57746596 TTTACAAATGTCTCCAGCAAAGG + Intergenic
955751481 3:62189101-62189123 TGCGCAAATGCCACCAGAGAAGG - Intronic
956162753 3:66372318-66372340 GCCACCACTGTCTCCAGAAAAGG - Intronic
957066683 3:75528551-75528573 TCCACAAATGTCTACAGCAGGGG + Intergenic
958943145 3:100336205-100336227 AACGCAAATGTCTCCAGAAAAGG - Intronic
961237558 3:125380654-125380676 GCTACAAATGGCACCACAAAAGG + Intergenic
961532778 3:127549658-127549680 TCCACACATGATAACAGAAATGG + Intergenic
962255797 3:133869356-133869378 TCCACAACTGGCCCCAGAGATGG - Intronic
964998916 3:162926851-162926873 TCCACCAATGTGGCCACAAATGG - Intergenic
965635197 3:170773607-170773629 TCCTCAGTAGTCACCAGAAAAGG - Intronic
967791470 3:193553577-193553599 TCCACAAATGTCACCAGAAATGG - Intronic
967869021 3:194214378-194214400 TCCAGTAATGTCACAAGAAAGGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
970586985 4:17523688-17523710 TCCACAAATGACAGAAGAGAAGG + Intronic
971246040 4:24928902-24928924 ACCATAAATGTCACCTGAAAAGG - Intronic
973163351 4:47046538-47046560 ACCACTAATGGCACCAAAAAAGG + Intronic
974444979 4:61968228-61968250 TCAAAAAATGTCACCAGAAAAGG - Intronic
975289214 4:72657304-72657326 TCCACTCATGTCACCAAATATGG + Intergenic
975543971 4:75543036-75543058 TCCACAGGTCTCACCAGCAAAGG + Intronic
976121624 4:81789772-81789794 TTCAGAAATATTACCAGAAAGGG - Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978319161 4:107475367-107475389 AACAAAAATGTCACCAAAAATGG + Intergenic
979407037 4:120325978-120326000 TCCAGAAATGTCCTAAGAAATGG + Intergenic
979514080 4:121586936-121586958 TCCACAAATCTCAGCACCAAGGG + Intergenic
981112621 4:140953299-140953321 TCAACGAATGTCACAGGAAAGGG - Intronic
982988272 4:162238159-162238181 TAAACAAATGTGACCAGAGAAGG - Intergenic
983790523 4:171792063-171792085 TCCAATGATGTCTCCAGAAAAGG - Intergenic
983850098 4:172569888-172569910 TCCACAGATTTAAACAGAAAGGG + Intronic
983861740 4:172715768-172715790 TCCAAAAATGTCACTGAAAATGG - Intronic
984294343 4:177834989-177835011 TCCAAAAATATCCCCAGAAAAGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984820589 4:183878218-183878240 TCTAAAAATGTCTCCAGCAAGGG - Intronic
985424679 4:189818202-189818224 TACAGAAATGTCAACAGAAGTGG - Intergenic
986535474 5:8782533-8782555 TAAACAAATATCAACAGAAAAGG - Intergenic
986646673 5:9923164-9923186 TGATCAAATGTCACTAGAAAAGG + Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988042489 5:25907887-25907909 ACCACAAATTTCACCAGGAAAGG + Intergenic
991348315 5:65693654-65693676 TCCACAAAAGTCAGCTGAATTGG - Intronic
992189028 5:74272605-74272627 TCCTCAAATCCCACCAGAGATGG + Intergenic
992744750 5:79808012-79808034 TCCACAAAGGTTACCATAACAGG - Intergenic
993914276 5:93723195-93723217 TCAACAAATCTCACCAGCTAAGG + Intronic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
996028728 5:118681455-118681477 TCAACGAATGTCACAAAAAAGGG - Intergenic
997633777 5:135389837-135389859 GTCACAAATGTCTCCTGAAAAGG + Intronic
997771855 5:136562488-136562510 GCCACAAATGTGCCTAGAAAAGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
998580941 5:143374964-143374986 ACCACAAATCTCATCAGTAAAGG + Intronic
1003263739 6:4548920-4548942 TTCACAAGTGTCACCAAAAAGGG + Intergenic
1005753275 6:28903294-28903316 TCCACAAATGTGACTGGTAAGGG + Exonic
1007026308 6:38578541-38578563 CCCACAGTTGTGACCAGAAAAGG + Intronic
1008632252 6:53373502-53373524 TCCACAAATATCTCCAACAATGG + Intergenic
1010905103 6:81477645-81477667 TTCACAAATTTCAACAGAAGGGG + Intergenic
1011444589 6:87424057-87424079 GCCCAAGATGTCACCAGAAATGG - Intronic
1014070011 6:117169817-117169839 TGCACAAATGTAAACACAAAAGG - Intergenic
1014330115 6:120053936-120053958 TCCTGAATTGTCACTAGAAATGG - Intergenic
1015256584 6:131184851-131184873 TCCACAAATGTCACAGGCATAGG + Intronic
1015960676 6:138645826-138645848 TCCACAAACATCACCAGAGCAGG + Intronic
1016791822 6:148074383-148074405 TCCACAAATTGAACCAGAATTGG - Intergenic
1017345629 6:153377190-153377212 TTCACAAAAGTCACCACAAAAGG + Intergenic
1020616756 7:10468130-10468152 TCCACAAATGACAACAGCATAGG - Intergenic
1021013579 7:15503010-15503032 TCCAAAAATGACACCAGTAATGG - Intronic
1021625281 7:22586948-22586970 TCCAGAAATGTCAACAGTATGGG - Intronic
1027427246 7:78073804-78073826 TCCACAAAGGTTAAGAGAAAAGG - Intronic
1030298524 7:107952843-107952865 TCCATCAATGCCACTAGAAAAGG + Intronic
1030301911 7:107982952-107982974 CCCACAAATTTCACCTTAAAGGG + Intronic
1030314347 7:108098536-108098558 CACACAAATGCCACCAGATATGG + Exonic
1030841862 7:114363794-114363816 TACACAAATATCAGCAGCAAAGG - Intronic
1032425587 7:131819943-131819965 TCCAGAAATGGCCCCAGAGAGGG - Intergenic
1033078113 7:138268304-138268326 TCCACAAATGGCACCAGCAGGGG + Intergenic
1033179510 7:139162130-139162152 TCAACAAATGAAACAAGAAAGGG + Intronic
1034027558 7:147722834-147722856 TCCTCAAATGTCAAAATAAAGGG + Intronic
1034385363 7:150736693-150736715 ACTTCAAATGTCAACAGAAAAGG + Intronic
1034547641 7:151799529-151799551 ACAATAAATGACACCAGAAAGGG - Intronic
1035196274 7:157223319-157223341 TCCTCAAATGGAACCACAAAAGG - Exonic
1035846876 8:2874925-2874947 TCCACTAATGTCACCACCAGGGG + Intergenic
1036053653 8:5227230-5227252 TGCACAAATGGAACCAAAAATGG + Intergenic
1037224753 8:16572236-16572258 ACCTCCAATGTCACCAAAAAAGG + Intergenic
1038548425 8:28444106-28444128 TACATGAATGTTACCAGAAAGGG - Intronic
1039144493 8:34431537-34431559 TTAAGAAATGTCACTAGAAAAGG - Intergenic
1039196785 8:35040969-35040991 TCAAAAAATGTCACAATAAATGG + Intergenic
1040573776 8:48632862-48632884 TCCACAAATGTTAAAAGAATGGG - Intergenic
1041599707 8:59701954-59701976 ACCACCAATGTCAACAGAATTGG - Intergenic
1042316019 8:67426857-67426879 TCCACAACTGTAACAAGAATTGG - Intronic
1042910888 8:73824906-73824928 TCCATAAATGCTAACAGAAAAGG - Intronic
1043049122 8:75362312-75362334 TCCATACATGTCACCAAATAGGG + Intergenic
1043149651 8:76698831-76698853 TCCACCCATGTCACGACAAAGGG - Intronic
1043841035 8:85104888-85104910 TACACAAAAATAACCAGAAATGG - Intergenic
1044249673 8:89991057-89991079 TCCACACATTGCACAAGAAAAGG + Intronic
1044434666 8:92147894-92147916 TCTACAAAGGGCACCAGAAAAGG - Intergenic
1045239333 8:100385137-100385159 CCCACATATGTCACCATAAAAGG + Intronic
1046204083 8:110966576-110966598 TCCATAAAATTCAGCAGAAAGGG + Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1050327000 9:4507560-4507582 TCCACAAATGTTAAGAGAGAAGG + Intronic
1052883608 9:33622304-33622326 TCCAAAAATGGCACCAGATAGGG - Intergenic
1053427073 9:38017197-38017219 GCCAGAAATGTGACCAAAAAGGG - Intronic
1057950730 9:99367313-99367335 TCTAAAAAGGACACCAGAAAAGG - Intergenic
1057964324 9:99488542-99488564 GTCACAAATGTCAGCAGAGAGGG - Intergenic
1058221770 9:102312401-102312423 TCAAAAAATGTTTCCAGAAAGGG - Intergenic
1058355282 9:104077214-104077236 TCCCCATCTGTTACCAGAAAGGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060764184 9:126281595-126281617 TCCCCAAATGGCACCAGCAAAGG + Intergenic
1061423669 9:130485935-130485957 GCCAAAAAAGCCACCAGAAAGGG - Intronic
1186305961 X:8257944-8257966 TGAATAAATGTCACCATAAAGGG + Intergenic
1187398698 X:18940499-18940521 TCCACAAAGATTAGCAGAAAGGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187752914 X:22487207-22487229 TCCATAAATGACAACAGGAATGG + Intergenic
1190746117 X:53322371-53322393 TCCACAAATTCCACAAGATAGGG - Intergenic
1191090125 X:56611253-56611275 TCCATAAATTTCACCAGCATTGG - Intergenic
1192730898 X:73801705-73801727 TTCACAAATGTCATCAGCTAAGG + Intergenic
1195545531 X:106108382-106108404 TCCACACATGGCAGAAGAAATGG + Intergenic
1195650497 X:107278452-107278474 TGGACAGATGTTACCAGAAAGGG + Intergenic
1195981299 X:110581306-110581328 TCCACTAATCTCCCCAGGAAGGG - Intergenic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196360806 X:114855233-114855255 TCCACTAATGTATCTAGAAATGG + Intronic