ID: 967795395

View in Genome Browser
Species Human (GRCh38)
Location 3:193593432-193593454
Sequence AAGAGGCCCCAGAATTAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967795395_967795402 19 Left 967795395 3:193593432-193593454 CCCCGTTAATTCTGGGGCCTCTT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 967795402 3:193593474-193593496 CTCTATCTCCAAAAATGTGCAGG 0: 1
1: 0
2: 1
3: 18
4: 244
967795395_967795404 30 Left 967795395 3:193593432-193593454 CCCCGTTAATTCTGGGGCCTCTT 0: 1
1: 0
2: 0
3: 7
4: 101
Right 967795404 3:193593485-193593507 AAAATGTGCAGGTGACTCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967795395 Original CRISPR AAGAGGCCCCAGAATTAACG GGG (reversed) Intronic
902127385 1:14227338-14227360 AAGAGGCCCCAGACATCACGGGG - Intergenic
904719789 1:32499400-32499422 AGGAGCTCCCAGAATTAATGGGG + Intronic
908390661 1:63680699-63680721 AAGAGGCAGCAGAATTAGCATGG + Intergenic
917665004 1:177217954-177217976 AAGAGGCCCCAAAGTTAAGTAGG + Intronic
924677422 1:246193834-246193856 AAGAAGGCCTAGAATTAAAGAGG - Intronic
1068599276 10:58938273-58938295 AAGAGGTCTCAGAGTTATCGTGG + Intergenic
1072259936 10:93660066-93660088 AAGAGAGCCCAGAATTAAATGGG + Intronic
1074613677 10:115044794-115044816 AAGAGTGACCAGAATTAAGGGGG + Intergenic
1075375253 10:121973756-121973778 AAGAGGCAACAGAATCAACTGGG + Intronic
1076509603 10:131003141-131003163 ACGAGTCCCAAGAATTAAAGAGG - Intergenic
1076738407 10:132468737-132468759 AAGAGGCCCCAGAAAAGACTCGG - Intergenic
1076784234 10:132741561-132741583 AGGATGCCCCAGAATGAAGGTGG + Intronic
1078936561 11:15956585-15956607 AGGCGGACCCAGAATTAAAGTGG + Intergenic
1082942187 11:58717971-58717993 CAGAAGCCCCAGATTTAACATGG - Intronic
1083395851 11:62391330-62391352 TAGATGCCCCAGAATTTAGGAGG - Intronic
1093697035 12:22172431-22172453 AAGATGTCCCAGAATTTACCTGG + Intronic
1096578833 12:52571460-52571482 AAGAGGCCCCAGAGTCATTGGGG + Intronic
1098194053 12:67980833-67980855 AAGAGGCACCAGAATAATGGTGG + Intergenic
1102830357 12:115992641-115992663 AAGAGGCCTCAGTATTAATTAGG + Intronic
1108380207 13:49847720-49847742 AAGAGACCCCAGAAGCAAGGAGG - Intergenic
1116256291 14:42560214-42560236 GAGAGGCCTCAGATTTAAGGAGG + Intergenic
1119198648 14:72736620-72736642 AGGAGGTCCCAGAATGAAGGAGG + Intronic
1119324922 14:73754114-73754136 AAGAGGCGCCAAAAATAACCAGG - Intronic
1119381774 14:74233700-74233722 AAGAGGCCCCTCAATTAGCCGGG + Intergenic
1128239225 15:66089608-66089630 ACGATGCCCAAGAATTAACTTGG - Intronic
1130830638 15:87594937-87594959 CTAAGGCCCCAGAATTAAAGAGG - Intergenic
1133069216 16:3234806-3234828 AAGAGGCCCCAGAGTGAGCCTGG - Exonic
1137981471 16:53073765-53073787 AGGAGGCCTCAGAATTATGGTGG - Intronic
1146587828 17:34097862-34097884 CTGAGGCCCCAGAATTAACATGG + Intronic
1147000692 17:37359631-37359653 AAGGGAACCCAGAATTAAGGCGG + Intronic
1149781842 17:59403755-59403777 AAGCAGCACCAGAATTAACATGG - Intergenic
1152596848 17:81241979-81242001 ATGCTGCCCCAGAATTAACCTGG + Intergenic
1155111633 18:22721315-22721337 CAGAGCCCTCAGAAATAACGCGG + Intergenic
1155161181 18:23196989-23197011 TAGAGGCCCCAGTATTGAGGAGG + Intronic
1155650103 18:28131360-28131382 AAGAGGCCACAGGAGTAAAGAGG + Intronic
1159634184 18:70785275-70785297 AAAAGACCCCAGAAATAAAGTGG + Intergenic
1159756478 18:72371691-72371713 AAGAGGCCTCACAATCAAGGTGG - Intergenic
1163776185 19:19219209-19219231 CAGTGGCCCCAGAAGTAGCGTGG - Exonic
1166596262 19:44052753-44052775 AAGACACCCCACAATTACCGTGG - Intronic
1167316506 19:48766386-48766408 AAAACCCCCCAAAATTAACGAGG - Intergenic
927749368 2:25653368-25653390 AAGAGGCCTCAGAATCATGGTGG - Intronic
930155424 2:48102722-48102744 GAGAGGCCTCAGAATTATGGCGG + Intergenic
932869815 2:75387569-75387591 AAGAGGCCTTAGAAATAACATGG - Intergenic
936898808 2:117460420-117460442 CAGAGCCCTCAGAAATAACGCGG - Intergenic
939722233 2:145668131-145668153 ATGAGGCCCCAAGATTAAAGGGG - Intergenic
1169197027 20:3688850-3688872 AAGAGGCCTCAGAACAAAGGTGG + Intronic
1170973513 20:21139230-21139252 AAGAAGGCTCAGAATTAACGGGG - Intronic
1171773843 20:29347937-29347959 AAGAGGCCTCAGAATCATGGTGG + Intergenic
1171815852 20:29785489-29785511 AAGAGGCCTCAGAATCATGGTGG + Intergenic
1173981787 20:47230116-47230138 AAGAAACCCCAGCATTAATGGGG + Intronic
1174920332 20:54695250-54695272 AAGAGGCTGCAGAAATAATGAGG - Intergenic
1177627933 21:23688853-23688875 AAGAGGCAGCAGAATGTACGTGG - Intergenic
1179495700 21:41770048-41770070 CAGAGGCCCCAGAATAAAGCTGG + Intergenic
1180319303 22:11306052-11306074 AAGAGGCCTCAGAATCATGGTGG + Intergenic
1181899040 22:26137307-26137329 AAGAGAACGCAGAATTAACCAGG + Intergenic
953446314 3:42971168-42971190 CAGAGGCCACAGAATTAGCTTGG + Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
960628632 3:119705381-119705403 AAGAGGCCAGAGAAGTAACTAGG - Intronic
963707521 3:148706247-148706269 AAGAGTCCACAGAATTCACACGG + Intronic
965267969 3:166571944-166571966 GAGAGGCCTCAGAATTATGGTGG - Intergenic
965489051 3:169314614-169314636 AAGATGCCCAAGAATGAAAGTGG + Intronic
967795395 3:193593432-193593454 AAGAGGCCCCAGAATTAACGGGG - Intronic
967818656 3:193819745-193819767 AAGAGGCCCGAGTATAAACAGGG - Intergenic
975382901 4:73723065-73723087 AAGAAGCCACAGGATCAACGTGG - Intergenic
980025809 4:127765121-127765143 ACAAGGCTCCAGATTTAACGGGG - Intronic
982285211 4:153726697-153726719 AATAGGCCCCAGAATTACCATGG - Intronic
983790030 4:171784445-171784467 AGGAGGCCCCACAATTATGGTGG + Intergenic
987012484 5:13781685-13781707 AAGAGGCCTCAGAATCACGGTGG - Intronic
991661773 5:68957953-68957975 AAGAGGCTGCAGAATAAACTTGG + Intergenic
994026491 5:95090492-95090514 AAGAGGTCCCAGACTTCACAAGG + Intronic
994042703 5:95276195-95276217 AAGAGGCAACAGAATGAACCAGG + Intronic
994524084 5:100881885-100881907 GAGAGGCCTCAGAATTATGGTGG - Intronic
997258701 5:132448939-132448961 ATGAGCCCTGAGAATTAACGGGG - Intronic
999608304 5:153340895-153340917 AAGAGGCCCCAAAATGCACATGG + Intergenic
999820317 5:155221241-155221263 AACAGGCACCAGAATTAGCCTGG + Intergenic
1003875671 6:10434174-10434196 AAGAGGCCCAAGACTGGACGTGG + Intergenic
1009857772 6:69286365-69286387 AAGAGGGCCCAGGATTAAGGGGG - Intronic
1012054906 6:94393881-94393903 AAGAAGCCCCAGAATAAACAAGG + Intergenic
1016456214 6:144233779-144233801 CAGAGGCCCTAGACTTAACTTGG + Intergenic
1017029181 6:150205879-150205901 AAGAGGCCACAGAAATAAGCTGG - Intronic
1017862665 6:158413485-158413507 CAGAGGCCCCAAATTTAACATGG - Intronic
1021230892 7:18086020-18086042 AGAAGGGCCGAGAATTAACGAGG - Intergenic
1026278566 7:68901947-68901969 AGGAGGCCTCAGAATCACCGTGG - Intergenic
1029105986 7:98176518-98176540 AATAGGCCCAAGAAATAAGGGGG + Intronic
1031277375 7:119745424-119745446 AAGAGGCCTCACAATTACGGTGG + Intergenic
1035202636 7:157277081-157277103 CTGAGGCCCCAGACTGAACGGGG - Intergenic
1035438278 7:158875694-158875716 CAGAGGCCCCTGAATCAACAAGG - Intronic
1035645360 8:1214578-1214600 AAGAGGCCACAGGATAAATGAGG - Intergenic
1038909682 8:31948892-31948914 AAGAGTCCTCTGAATTAACCAGG - Intronic
1039039251 8:33391793-33391815 AAGTGGGTCCAGAATTAACTGGG + Intronic
1040442291 8:47456316-47456338 GAGAGGCCTCAGAATAAACCAGG + Intronic
1043204938 8:77426258-77426280 AAGAGGCCCGAGATTTATCTCGG - Intergenic
1043534248 8:81183989-81184011 AAGAGACAACAGAATTAAAGTGG + Intergenic
1044432809 8:92128353-92128375 AATAGGCTCCATAGTTAACGTGG + Intergenic
1046539177 8:115557017-115557039 AAGAGGCCTCACAATCAAGGTGG + Intronic
1047639280 8:126800934-126800956 CAGAGCCCTCAGAAATAACGCGG - Intergenic
1047646231 8:126873514-126873536 AAGAGTCCCCAGAATTAGTCTGG + Intergenic
1052078220 9:24171504-24171526 AAGAAGCCTGAGAATTAACTTGG - Intergenic
1053350815 9:37412182-37412204 AAGTGCCCCCAGAATAAACCAGG - Intergenic
1053588910 9:39490429-39490451 AGGAGGCCTCAGAATTATGGTGG - Intergenic
1054577395 9:66874866-66874888 AGGAGGCCTCAGAATTATGGTGG + Intronic
1054999812 9:71436225-71436247 AGGAGGCCTCAGAATCAAGGCGG - Intronic
1061905521 9:133694708-133694730 TAGGAGCCCCAGAATGAACGGGG - Intronic
1203367533 Un_KI270442v1:271803-271825 AAGAGGCCTCAGAATCATGGTGG + Intergenic
1187726788 X:22211787-22211809 AGGAGGCCTCACAATTATCGTGG + Intronic
1190950294 X:55136981-55137003 AAGAGGTGCCAGAGTTAATGAGG + Intronic
1192133397 X:68574280-68574302 AAAAGGCCCTAGAATTTACTTGG - Intergenic
1196208963 X:112973123-112973145 AAGAGGCTCCAGAATAATGGGGG - Intergenic
1201385909 Y:13439370-13439392 AAAAGGCCCAAGAAGTAACGTGG + Intronic