ID: 967798264

View in Genome Browser
Species Human (GRCh38)
Location 3:193623148-193623170
Sequence CTTTTGCTATGTAAGGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967798264_967798270 -6 Left 967798264 3:193623148-193623170 CCTATATCCTTACATAGCAAAAG 0: 1
1: 0
2: 1
3: 14
4: 220
Right 967798270 3:193623165-193623187 CAAAAGGGGCCAGGCAGCTCTGG 0: 1
1: 0
2: 2
3: 22
4: 207
967798264_967798272 9 Left 967798264 3:193623148-193623170 CCTATATCCTTACATAGCAAAAG 0: 1
1: 0
2: 1
3: 14
4: 220
Right 967798272 3:193623180-193623202 AGCTCTGGCCTTTTTTTGTAAGG 0: 1
1: 0
2: 0
3: 23
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967798264 Original CRISPR CTTTTGCTATGTAAGGATAT AGG (reversed) Intronic
902570709 1:17345423-17345445 GTTTTGAAATGTGAGGATATAGG + Intronic
905927081 1:41758744-41758766 CATTTGTGATGAAAGGATATGGG + Intronic
906938375 1:50234554-50234576 CTCTTGCTATGCAAAGATACTGG + Intergenic
907535447 1:55151429-55151451 CTATGGCTATGTAAGGCTTTTGG + Intronic
908090941 1:60685325-60685347 CTCTTGCTATGCAAAGAGATTGG + Intergenic
909236008 1:73153253-73153275 CTCTTGCTATGCAAAGATACTGG - Intergenic
909685898 1:78348392-78348414 ATTTTGCCATGTAAGGAAAAAGG + Intronic
910159258 1:84256071-84256093 TTTTTGCTATGTGAGAATGTGGG - Intergenic
914324463 1:146598021-146598043 CTCTTGATGTGTAAGGATTTTGG + Intergenic
917180692 1:172294001-172294023 CCTTTACTATGTAAAGGTATGGG - Intronic
918870054 1:189959961-189959983 CTCTTGCTAAGTAAGTATCTTGG + Intergenic
919821860 1:201478278-201478300 CCTTTGCTATGTTAAGCTATTGG - Intergenic
921407400 1:214796064-214796086 CTTTTATTATGAAGGGATATTGG + Intergenic
1063174205 10:3536871-3536893 CTTTTGATATATCAGGAAATAGG - Intergenic
1064830234 10:19456166-19456188 GTTTTGCTATGTATGAATGTAGG - Intronic
1065105671 10:22381407-22381429 GTGTTGCTATGTAGGAATATAGG - Intronic
1065142947 10:22737355-22737377 GTTTTACTATGAAAGGACATAGG - Intergenic
1065261030 10:23923412-23923434 CCTTTGCCATATAAGGATGTAGG - Intronic
1071209756 10:83326127-83326149 CTTTTGCTTTGTAAGAAGTTTGG + Intergenic
1071327665 10:84533351-84533373 CTCTTGCTATGCAAAGAGATTGG + Intergenic
1071990644 10:91097842-91097864 CTTTTGCTATGCAAAGAGACTGG - Intergenic
1072035868 10:91562235-91562257 CTTTTGCTATGCAAAGAGACTGG - Intergenic
1072866567 10:99068013-99068035 CTTTTGCTATGCAAAGAGACTGG - Intronic
1074662840 10:115681860-115681882 TTTTTGCTGTGTAAGGAGAAAGG + Intronic
1074836474 10:117300790-117300812 CTTCTGCCATGTGAGGACATAGG + Intronic
1076033575 10:127179682-127179704 ATTTTGTTATGAAAGGAAATGGG + Intronic
1078024610 11:7682963-7682985 ATTTAGCAATGTGAGGATATTGG - Intergenic
1078828984 11:14960794-14960816 ATTTTGCTATGTTATAATATGGG - Intronic
1080956502 11:37102879-37102901 CTTTTGCTATGTACAGCTATAGG - Intergenic
1081144531 11:39546260-39546282 CATTTGATATGTAAGCCTATTGG - Intergenic
1085272206 11:75277085-75277107 CTTTGGTTATGGAAGGAAATGGG - Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085668573 11:78439704-78439726 CTTTTGGTATGGAAGGAGATAGG - Intronic
1087489921 11:98812250-98812272 GTTTTGCCATGTGAGGATACAGG - Intergenic
1087649978 11:100854256-100854278 CTTTTCCTATGGAAATATATTGG - Intronic
1087698350 11:101407150-101407172 CTTTTGCCATGTAAGGATGCAGG - Intergenic
1092696356 12:11175874-11175896 CTTTTGCCATGTAAGGTTATAGG + Intergenic
1093993086 12:25611778-25611800 CTATTGCTCTCTAAGGAAATGGG - Intronic
1094198244 12:27771607-27771629 CTTTTGCTAAGTAAATATAAAGG + Intergenic
1097441194 12:59611029-59611051 CTTCTGCTATGTAAGCACACAGG - Intronic
1098354311 12:69596427-69596449 CTTTTGCTTAGTTAGGAAATAGG + Intronic
1100929205 12:99586298-99586320 CTCTTGCTATGCAAGGAGACTGG - Intronic
1101229847 12:102729304-102729326 CTTTAGCCATGTAAGGATGGGGG + Intergenic
1104271573 12:127287073-127287095 CTTTTGCTATGGAAGAAGACTGG - Intergenic
1105535032 13:21257933-21257955 CTTTTGCTTTGTCAGAACATAGG - Intergenic
1107316222 13:39135142-39135164 GTATTTCTATGTAAGGATATGGG + Intergenic
1108850837 13:54727494-54727516 CTCTTGCTATGCAAAGATACTGG + Intergenic
1109792847 13:67272206-67272228 CTTTTGGTATGTAATTATAATGG + Intergenic
1111307453 13:86434067-86434089 CTTTTGCTATGCAAAGAGACTGG + Intergenic
1111312333 13:86504764-86504786 CTTCCACTATGTAAGGACATAGG + Intergenic
1111403390 13:87769989-87770011 CTCTTGCTATGTAAAGAGACTGG - Intergenic
1111714467 13:91862786-91862808 CTTTTGCTATGAAACATTATTGG - Intronic
1112608039 13:100927303-100927325 CTTTTGCCATGTGAAGATCTGGG + Intergenic
1113010830 13:105763725-105763747 ATTTTTCTATTTTAGGATATGGG + Intergenic
1114332666 14:21652754-21652776 CTTTTGTTATCTATGCATATTGG + Intergenic
1116278707 14:42872289-42872311 CTTTTATTATGTATAGATATTGG - Intergenic
1116286973 14:42986329-42986351 CTCTTGCTATGCAAGGAGACTGG - Intergenic
1117854264 14:60010789-60010811 CTCTTGCTATGCAAAGAGATTGG - Intronic
1123736364 15:23188012-23188034 CTTTTGCTATGAAACATTATTGG - Intergenic
1124287070 15:28410989-28411011 CTTTTGCTATGAAACATTATTGG - Intergenic
1124295631 15:28500640-28500662 CTTTTGCTATGAAACATTATTGG + Intergenic
1125091920 15:35802877-35802899 CTTCTGCTATGTGAGGACACAGG - Intergenic
1127492086 15:59474445-59474467 CTTTTGCAATGTGAGGACACAGG - Intronic
1130824153 15:87526449-87526471 CTTTTGCTATTTTATGGTATGGG - Intergenic
1131208691 15:90474313-90474335 CTATTGCTATGTTATGATAAAGG - Intronic
1131680486 15:94716871-94716893 CTTTTGCTAAGTAAGGTCAAGGG - Intergenic
1131700999 15:94935227-94935249 CTTTTGCTATGCAAAGAGACTGG - Intergenic
1135523046 16:23191993-23192015 CTTTTGATATGATAGGAAATGGG + Intronic
1136494251 16:30632411-30632433 CTTTTGTTGTGTATGGACATGGG + Intergenic
1137993632 16:53185338-53185360 CTTTTGCTATGCAAAGAGACTGG + Intronic
1138631092 16:58294685-58294707 CTGTTCCTATGTAAAGATACAGG - Intronic
1139509208 16:67416680-67416702 CTTTTGAGATGTTAGGATTTCGG - Intronic
1140009097 16:71112826-71112848 CTCTTGATGTGTAAGGATTTTGG - Intronic
1141473597 16:84256650-84256672 CTTTTGCTAGCTAAGTAAATAGG + Intergenic
1155874802 18:31073206-31073228 ATTTTGCTAAGTAAGACTATTGG + Intronic
1156503245 18:37572998-37573020 CTGCAGCTATGGAAGGATATAGG + Intergenic
1156641243 18:39102075-39102097 ATTGTGCTATGTAAGGAACTTGG + Intergenic
1159470358 18:68846472-68846494 CTTTGGATATGTAAGCATGTGGG + Intronic
1159758272 18:72392657-72392679 CTCTTTCTATGTAAGGAGAATGG - Intergenic
1164006734 19:21156633-21156655 CTTTAGCTTTCTAAGGATAATGG + Intronic
925186883 2:1853526-1853548 GTCTTCCTATGTAAGCATATGGG - Intronic
933273956 2:80264244-80264266 ATTTTGCTATTTAACGATATTGG + Intronic
933286913 2:80394587-80394609 CATTTGATATGAAATGATATGGG + Intronic
933472812 2:82748692-82748714 TTTTTAATATGAAAGGATATTGG + Intergenic
933798787 2:85943092-85943114 CTGTTGCTATGCAAGGAGACTGG - Intergenic
934123514 2:88863376-88863398 CATTTGCTAAGTAAAGATACTGG - Intergenic
935161908 2:100536763-100536785 TATTTGCTATGTAAGGCTATGGG - Intergenic
936872239 2:117146806-117146828 CTTTTGCTATGCAAAGAGACTGG - Intergenic
936918130 2:117660977-117660999 CTGTTGCTATGTAACCAAATAGG - Intergenic
938234531 2:129694879-129694901 CTTTTCCTTTGTAAGAATTTTGG - Intergenic
939653510 2:144793022-144793044 TTTTTGCTTGGTAAGGATATAGG + Intergenic
939678470 2:145101293-145101315 CTTTTGCTATGAAATGGTATTGG - Intergenic
940624900 2:156161930-156161952 CTTTTGCTATTTAAGAACACTGG + Intergenic
943176542 2:184481981-184482003 CTTTTACTATACAAGGACATTGG + Intergenic
943360076 2:186908666-186908688 ATTTTGCAGTGTAAGGATGTAGG + Intergenic
943705809 2:191033000-191033022 CTTTGGGAATGTCAGGATATAGG + Exonic
944342746 2:198622443-198622465 CGTTTGCCATTTAAGGTTATAGG - Intergenic
944939559 2:204608772-204608794 CTTTTGCAGTGTGATGATATTGG + Intronic
948009043 2:234636169-234636191 CTCTTGCTATGCAAGGAGACTGG + Intergenic
1170156255 20:13272160-13272182 TTTCTGCTATGTAAGCAAATTGG - Intronic
1171088188 20:22258346-22258368 TGTTTGCTAGGCAAGGATATTGG + Intergenic
1174326982 20:49787110-49787132 CATTTGCTAAGCAAGGATAATGG - Intergenic
1176231196 20:64033946-64033968 CCTTAGCTGTGTAAGGATAAAGG + Intronic
1177167155 21:17615188-17615210 CTCTTGCCAAGTGAGGATATAGG + Intergenic
1182167445 22:28190669-28190691 CTTTTCCTATGTGGGAATATGGG - Intronic
1182790773 22:32951065-32951087 CTTTGGCTATGAAAGAATTTAGG - Intronic
949404790 3:3702873-3702895 CATTTTCTATGTGAGGAAATGGG + Intronic
950741552 3:15056405-15056427 CTTTTGCTGTGTAAGGTTCTGGG - Intronic
955873967 3:63471016-63471038 CTTTTGCCATGTAAGTAACTTGG + Intronic
959357253 3:105347809-105347831 CCTTTGCTATGTGAGGAAATAGG - Intergenic
960362813 3:116734884-116734906 CTTTTGCTATGCAAAGAGACTGG + Intronic
961097598 3:124171162-124171184 GTAATGCTATGTAAGGATTTGGG + Intronic
964461032 3:156928509-156928531 TTTTTTCTTTTTAAGGATATTGG + Intronic
964875344 3:161360930-161360952 CTATAGATATGTAAGAATATTGG - Intronic
964879352 3:161406367-161406389 CTTCTGCCATGTGAGGATATAGG + Intergenic
966264716 3:178025839-178025861 CTTTTGCTATAGAAACATATAGG + Intergenic
966528614 3:180947823-180947845 CTTTTGGGATGAATGGATATAGG + Intronic
967798264 3:193623148-193623170 CTTTTGCTATGTAAGGATATAGG - Intronic
968197890 3:196724399-196724421 TTTTTGGCTTGTAAGGATATGGG + Intronic
973642438 4:52916760-52916782 CTTTTCCTTTGTTAGGACATGGG - Intronic
976459189 4:85288105-85288127 TTTTTACCATGAAAGGATATTGG - Intergenic
980023754 4:127740235-127740257 CTTTTTCTATGTAACATTATTGG + Intronic
980345395 4:131609899-131609921 ATTTTCCTATTTAATGATATTGG + Intergenic
982777866 4:159460547-159460569 CTAGTGCTATATAAGAATATAGG - Intergenic
983006669 4:162492860-162492882 CTCTTGCTATGTAAAGATGCTGG + Intergenic
983825059 4:172249236-172249258 CTCTTGCTATGCAAAGATACTGG + Intronic
983863209 4:172734093-172734115 CTCTTGCTATGCAAAGATACTGG + Intronic
984399408 4:179242689-179242711 CATTTGCGACGTAAGAATATTGG - Intergenic
986045673 5:4035173-4035195 CTTTTTAAAAGTAAGGATATAGG - Intergenic
987165261 5:15191567-15191589 GTTTTGCTATGAGAGGAGATAGG + Intergenic
987642430 5:20629398-20629420 CTTTTGCTATGCAAAGAGACTGG - Intergenic
987695596 5:21325593-21325615 CTTTTGCTATGAAGGGATGATGG - Intergenic
990652362 5:57916031-57916053 TATTTGCTATGTAAAGATACTGG + Intergenic
991292939 5:65050440-65050462 CTTTTGCCATGTAAGGACACAGG - Intergenic
991408943 5:66328132-66328154 CTTCAGGTATGTAAGGAAATTGG - Intergenic
991665600 5:68996654-68996676 ATTTTTCTATGGAAGGAGATCGG - Intergenic
991744807 5:69726505-69726527 CTTTTGCTATGAAGGGATGATGG + Intergenic
991752898 5:69828721-69828743 CTTTTGCTATGAAGGGATGATGG - Intergenic
991796377 5:70306233-70306255 CTTTTGCTATGAAGGGATGATGG + Intergenic
991802516 5:70385455-70385477 CTTTTGCTATGAAGGGATGATGG - Intergenic
991824187 5:70601819-70601841 CTTTTGCTATGAAGGGATGATGG + Intergenic
991832217 5:70703849-70703871 CTTTTGCTATGAAGGGATGATGG - Intergenic
991888755 5:71305789-71305811 CTTTTGCTATGAAGGGATGATGG + Intergenic
992437043 5:76764459-76764481 CTTTTATTATGAAAGGATGTTGG + Intergenic
993208730 5:84920925-84920947 CTCTTGCTATGCAAAGAAATTGG + Intergenic
994148913 5:96425631-96425653 GTTTTGCTGAGTAAGGATGTTGG - Intronic
994647315 5:102486114-102486136 ATTTAGCTATGTAAAGCTATAGG + Intronic
995889426 5:116934245-116934267 CTTCAGCTATATAAGGATCTTGG - Intergenic
996486895 5:124046288-124046310 ATTTTGCTATGAAGGGATAAAGG - Intergenic
997088398 5:130827559-130827581 CTCTTGCTATGCAAAGATACTGG - Intergenic
997549544 5:134739673-134739695 CTTTTGTTCTGTAAGGCTTTAGG + Intronic
998064070 5:139142584-139142606 TTTTTATTATGAAAGGATATTGG - Intronic
999572562 5:152937246-152937268 CTTTCACTATGTGAGGACATAGG + Intergenic
1000260860 5:159587279-159587301 ATTTTGCTATGAAAAGAAATGGG + Intergenic
1000510116 5:162170587-162170609 AGTTTGCTAAGTAAGGATAATGG - Intergenic
1003376184 6:5579967-5579989 CTTTTGCTTTGTCAGAACATAGG + Intronic
1003403162 6:5807489-5807511 ATCTTGCAATGTAAGGACATGGG + Intergenic
1003475396 6:6477505-6477527 GTCTTTCTATGTAAGGAAATGGG - Intergenic
1003538415 6:6996596-6996618 CTTCTGCTATGTGAGGACACAGG + Intergenic
1004094048 6:12535063-12535085 CTTTAGTTAGGTAAGAATATTGG + Intergenic
1005555187 6:26972473-26972495 CTTTTGCTATGAAGGGATGATGG + Intergenic
1006997797 6:38278502-38278524 CATTTTCTTTGTAAGGCTATAGG + Intronic
1007849990 6:44793589-44793611 CTTTACCTAAGCAAGGATATTGG - Intergenic
1009673268 6:66785013-66785035 CTTTTTCTTTATAAGAATATTGG + Intergenic
1009763124 6:68034771-68034793 CTTCTGCCATGTGAGGACATGGG + Intergenic
1009944476 6:70326909-70326931 ATTTTTCTTTGTAAGCATATAGG - Intergenic
1010056111 6:71567070-71567092 TTTCTGCCATGTGAGGATATAGG + Intergenic
1011929061 6:92687121-92687143 CACTTGCTATGTAATGGTATTGG + Intergenic
1012385941 6:98683139-98683161 CTTCTGCTATGCAAGAATAGAGG + Intergenic
1012917488 6:105186226-105186248 CTTTTCCTATGGAGTGATATTGG + Intergenic
1014117393 6:117681004-117681026 CTTTTGCTATGTCTGTATTTAGG + Intronic
1014652482 6:124057114-124057136 CATTTGCTAAGTAAATATATAGG + Intronic
1015299381 6:131635208-131635230 CTTTTGCTGGTTAGGGATATAGG + Intronic
1016285095 6:142463611-142463633 CTCTTGCTATGCAAAGAGATTGG - Intergenic
1016866249 6:148770304-148770326 CATTTTCTATGTAAAGATGTGGG + Intronic
1019150951 6:170005378-170005400 CTCTTGCTATGCAAGGAGACTGG - Intergenic
1023242095 7:38159665-38159687 CTTCTGCCATGTAAGAATTTGGG - Intergenic
1025477985 7:60951196-60951218 CTTTTGCTATCTTGAGATATGGG + Intergenic
1026182452 7:68053955-68053977 CTTCTGCTATGTAAGAATCCAGG + Intergenic
1026501517 7:70946965-70946987 CCTTTGCAATGTAAGGAGCTTGG + Intergenic
1026662348 7:72313352-72313374 ATTTGGCTATGGTAGGATATAGG - Intronic
1027869256 7:83685877-83685899 CTTTAGATTTGTTAGGATATTGG - Intergenic
1028023620 7:85808571-85808593 CTCTTGCTATGCAAAGAGATTGG + Intergenic
1028070989 7:86450453-86450475 CTTTTGATATGTGTGGATGTAGG + Intergenic
1030191125 7:106811036-106811058 CACTTACTCTGTAAGGATATAGG + Intergenic
1031513023 7:122672218-122672240 CTGTTGTTATGAAAGGATGTAGG - Intronic
1031904859 7:127449221-127449243 CTTTTGTCATGAAGGGATATTGG - Intergenic
1032689583 7:134269898-134269920 CTTTTATTATGAATGGATATTGG - Intergenic
1032999077 7:137482874-137482896 CTTGTCCTAAGGAAGGATATGGG + Intronic
1033929038 7:146501202-146501224 CTTTTGGTATGAAGGTATATAGG + Intronic
1037088896 8:14888206-14888228 CTTTTGTCATTTAAGGATAAAGG - Intronic
1039082420 8:33745920-33745942 CTCTTGCTATGTAAAGAGACTGG - Intergenic
1039274050 8:35915419-35915441 CTTCTACCATGTAAGGATACAGG - Intergenic
1040922595 8:52639601-52639623 CTTTTTATTTGTAAGTATATGGG - Intronic
1041984717 8:63908725-63908747 ATTTTGAAATGTGAGGATATGGG - Intergenic
1042656177 8:71099584-71099606 CTTTTGCTATGTTGATATATAGG - Intergenic
1043244907 8:77986144-77986166 CTTTAGATAGGTAAAGATATAGG - Intergenic
1043585333 8:81761955-81761977 CTTTTGTTATTGAAGGATACAGG - Intergenic
1044095153 8:88054646-88054668 ATTTTGCTATGGAAAAATATAGG + Intronic
1044347024 8:91117265-91117287 CTTTTGCTATGTAATGCTACAGG + Intronic
1046301042 8:112289922-112289944 GATTTGCTAAGTAAGGACATAGG + Intronic
1047398207 8:124522996-124523018 CTTTTGCTTTCTACAGATATTGG - Exonic
1047890032 8:129298189-129298211 GTTTTGTTATATAAGAATATGGG + Intergenic
1050237775 9:3600338-3600360 CTTTGGATATGTATGGATAGAGG - Intergenic
1050949978 9:11576822-11576844 CTTTACCTATGGAAGGACATAGG + Intergenic
1051013462 9:12447472-12447494 CTCTTGCTATGCAAAGAGATTGG + Intergenic
1051493371 9:17692182-17692204 TGCTTGCTATGTATGGATATGGG + Intronic
1051716010 9:19984763-19984785 CTTTTGCTATTGAACGATGTTGG - Intergenic
1051868726 9:21712248-21712270 CTTTTGTTATGAAAGTATGTTGG - Intergenic
1052012300 9:23424794-23424816 CTTTTGCAATATAATGATCTTGG + Intergenic
1052449530 9:28610957-28610979 CTTTTGGTAATTAAGGATAATGG - Intronic
1055512321 9:77007360-77007382 CTACTGCTATGTAAACATATTGG - Intergenic
1055687286 9:78790242-78790264 ATTTTGCTTTGTAAGCATTTGGG + Intergenic
1058103544 9:100943763-100943785 GTTTTACTATGAAAGAATATTGG + Intergenic
1058646510 9:107135968-107135990 CTTTTGCCCTGTAAGGATTTGGG - Intergenic
1060460072 9:123844013-123844035 TTTTTATTATGAAAGGATATTGG - Intronic
1185824693 X:3238875-3238897 TTTTTGCTATGTAAATATACAGG + Intergenic
1187214583 X:17264268-17264290 CTTTTGCTATGCAAAGAGACTGG + Intergenic
1187715371 X:22097258-22097280 CTTTTGTCATGTGAGAATATAGG - Intronic
1188138360 X:26517945-26517967 CTTCTGCCATGTAAGGAGACAGG - Intergenic
1188411759 X:29881378-29881400 ATTCTGCTCTGTCAGGATATGGG + Intronic
1188857168 X:35210402-35210424 CTCTTGCTATGTAAAGAGACTGG - Intergenic
1189318534 X:40073316-40073338 CCTTTGCCATGTAAGGAGAGGGG + Exonic
1189774483 X:44458150-44458172 CTTCTGCCATGTAAGTATACAGG - Intergenic
1189788640 X:44582807-44582829 CTCTTGCTATGCAAAGAGATTGG + Intergenic
1189877879 X:45455603-45455625 CTTTTGCTATGCAAAGAGACTGG + Intergenic
1193388117 X:80894669-80894691 CTTTTGCTATGCAAAGAAACTGG + Intergenic
1193723981 X:85019353-85019375 CTTCTGCCATGTAAGGATGCTGG + Intronic
1194082976 X:89490617-89490639 CTTTTGCTATGCAAAGAGACTGG - Intergenic
1196197293 X:112849532-112849554 CTTATGCTTTGGAGGGATATGGG + Intergenic
1196476576 X:116093213-116093235 CTTTTGCCATGTAAGGTAACAGG - Intergenic
1196777396 X:119352034-119352056 CTTTTCCTGTGTTAGGATAATGG - Intergenic
1197536271 X:127692053-127692075 GTTTTGAAATGTAAGGACATGGG + Intergenic
1198501472 X:137253041-137253063 CTTTTCTTATGTAAGCATTTAGG - Intergenic
1200435628 Y:3146490-3146512 CTTTTGCTATGCAAAGAGACTGG - Intergenic
1202092837 Y:21212117-21212139 CTATTCCTACGTAAGGATTTTGG - Intergenic