ID: 967806234

View in Genome Browser
Species Human (GRCh38)
Location 3:193716762-193716784
Sequence CTTGGCAATGCCAAGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967806224_967806234 7 Left 967806224 3:193716732-193716754 CCAATACTGTGTCCCTGGCCAGG No data
Right 967806234 3:193716762-193716784 CTTGGCAATGCCAAGGTTCTGGG No data
967806228_967806234 -5 Left 967806228 3:193716744-193716766 CCCTGGCCAGGGAGCTGGCTTGG No data
Right 967806234 3:193716762-193716784 CTTGGCAATGCCAAGGTTCTGGG No data
967806230_967806234 -6 Left 967806230 3:193716745-193716767 CCTGGCCAGGGAGCTGGCTTGGC No data
Right 967806234 3:193716762-193716784 CTTGGCAATGCCAAGGTTCTGGG No data
967806223_967806234 8 Left 967806223 3:193716731-193716753 CCCAATACTGTGTCCCTGGCCAG No data
Right 967806234 3:193716762-193716784 CTTGGCAATGCCAAGGTTCTGGG No data
967806221_967806234 23 Left 967806221 3:193716716-193716738 CCTGGAAGTGTGTTGCCCAATAC No data
Right 967806234 3:193716762-193716784 CTTGGCAATGCCAAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967806234 Original CRISPR CTTGGCAATGCCAAGGTTCT GGG Intergenic
No off target data available for this crispr