ID: 967811640

View in Genome Browser
Species Human (GRCh38)
Location 3:193765819-193765841
Sequence CAGCTCACTCCCACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 450}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967811640_967811646 13 Left 967811640 3:193765819-193765841 CCCCCTGGGGTGGGAGTGAGCTG 0: 1
1: 0
2: 4
3: 43
4: 450
Right 967811646 3:193765855-193765877 AGCCACATGACGTGTGTACATGG 0: 1
1: 0
2: 0
3: 4
4: 73
967811640_967811649 22 Left 967811640 3:193765819-193765841 CCCCCTGGGGTGGGAGTGAGCTG 0: 1
1: 0
2: 4
3: 43
4: 450
Right 967811649 3:193765864-193765886 ACGTGTGTACATGGGACCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 89
967811640_967811647 14 Left 967811640 3:193765819-193765841 CCCCCTGGGGTGGGAGTGAGCTG 0: 1
1: 0
2: 4
3: 43
4: 450
Right 967811647 3:193765856-193765878 GCCACATGACGTGTGTACATGGG 0: 1
1: 0
2: 0
3: 5
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967811640 Original CRISPR CAGCTCACTCCCACCCCAGG GGG (reversed) Intergenic
900887230 1:5423621-5423643 CAGCCCACTCCCACCCCACCTGG - Intergenic
902289086 1:15425109-15425131 CATCTCACCCCCACCCTAGATGG - Intronic
902320989 1:15665810-15665832 CTGCTCACCCTCACCACAGGTGG - Exonic
902503038 1:16923083-16923105 CAGCTCACACCTTCCCCGGGTGG - Intronic
902616465 1:17626108-17626130 CTCCTCCCTCCTACCCCAGGAGG - Intronic
902810275 1:18884227-18884249 GAGCTGACGCCCACCCCAGAGGG + Intronic
903276587 1:22225927-22225949 CAGCTGACCCCAACCCCAGTTGG - Intergenic
903663135 1:24990915-24990937 CAGCTCTCTCCCACACCACAAGG + Intergenic
903769295 1:25753884-25753906 CTGCCCCCGCCCACCCCAGGAGG - Intronic
904364119 1:29999676-29999698 CAGGTCCCTCCCACACCATGAGG + Intergenic
904473322 1:30748945-30748967 CTTCTCACACCCACTCCAGGAGG - Intronic
904579340 1:31529133-31529155 CAGGTCTCTCCCTCCACAGGTGG + Intergenic
905500429 1:38432185-38432207 CAGTGCACTCCATCCCCAGGAGG + Intergenic
905775045 1:40663028-40663050 CAGTTCACACACACCCCAGCTGG + Intronic
906038482 1:42767520-42767542 GAGCTCACCCCGACCCCCGGCGG + Exonic
906370076 1:45246436-45246458 CAGCTCCCTCCCACAACATGTGG - Intronic
906706525 1:47899158-47899180 CATCTGACTTCCACTCCAGGTGG + Intronic
906955843 1:50372967-50372989 CAGCTCCCTCACCCCTCAGGTGG + Intergenic
907667971 1:56449955-56449977 GGGCTCACACCCAGCCCAGGGGG + Intergenic
908076282 1:60522865-60522887 CAGATCCCTCCCACAACAGGTGG + Intergenic
908195478 1:61742688-61742710 CGGCTCCCACCCACTCCAGGCGG - Intronic
908237378 1:62159627-62159649 CAGCTCACTCCAACCTCTGCAGG + Intronic
908853534 1:68397185-68397207 CAGGTCCCTCCCACAACAGGTGG + Intergenic
910992016 1:93066494-93066516 CAGCTCACTCCCTCCCTGGAAGG - Intergenic
911231226 1:95363470-95363492 CAGCTCAATCCCACACCATGTGG - Intergenic
912239769 1:107893694-107893716 CAGGTCACTCCCACAACATGTGG + Intronic
912969451 1:114266888-114266910 CAGCTCCCTCCCACACCACATGG + Intergenic
913255482 1:116949545-116949567 CAGGTCACACCCACACCAGCTGG - Exonic
915210946 1:154308886-154308908 CAGGTCACTCCCACAACACGAGG - Intergenic
915746052 1:158158774-158158796 CAGCTCACATCCATCCCATGAGG - Intergenic
916045758 1:160998990-160999012 CTCCTCACTCCAGCCCCAGGTGG + Intronic
918117005 1:181506374-181506396 CTGCTCACTCCCACCCTTGCAGG - Intronic
918783489 1:188732717-188732739 CAGGTCACTCCCACAACAGGTGG + Intergenic
920421709 1:205838883-205838905 CACCTCTCTCCCACCTCTGGTGG + Intronic
921399755 1:214708187-214708209 CACCCCATTCCCACCCCTGGTGG - Intergenic
922158065 1:223055445-223055467 CTGCTCATTGCCACCCCAAGAGG + Intergenic
922474709 1:225899075-225899097 CAGCTCATCCCCACCCATGGAGG + Intronic
922667545 1:227485660-227485682 CAGGTCACTCCCACAACATGTGG - Intergenic
922989410 1:229893806-229893828 CAGCCCCACCCCACCCCAGGAGG + Intergenic
923179550 1:231502992-231503014 CAGCTCCCTCCCACAACAAGTGG - Intergenic
924243743 1:242062279-242062301 AAGCTGACTCTCACCCAAGGTGG - Intergenic
1062859105 10:796099-796121 CAGGTCACTCCCACAACACGTGG - Intergenic
1064930923 10:20625562-20625584 CAGGTCCCTCCCACAACAGGTGG + Intergenic
1067058713 10:43066808-43066830 CAGCTCACAGCATCCCCAGGTGG - Intergenic
1068243420 10:54335480-54335502 CAGCTCCCTCCCACAACACGTGG - Intronic
1069844016 10:71358306-71358328 TGGCTCACTACCAGCCCAGGGGG - Intronic
1070257516 10:74825231-74825253 CACCTCAGTCCCAGCCCTGGCGG + Intergenic
1070328527 10:75402764-75402786 CACCCCACCCCCATCCCAGGAGG - Intergenic
1070393695 10:75993138-75993160 CAACCCACACCCAGCCCAGGAGG - Intronic
1070689537 10:78514393-78514415 CAGCTCACTACCTCCCACGGTGG - Intergenic
1070935759 10:80293671-80293693 CTGCTCCCACCCTCCCCAGGTGG - Intergenic
1071504056 10:86222313-86222335 CAGGTGCCTCCCAGCCCAGGGGG + Intronic
1072420859 10:95290079-95290101 CACCTCAACCCCACCCCAGGTGG + Intronic
1072867459 10:99079251-99079273 CAGCTCTTTCCCTCCCCAGAGGG + Intronic
1073988089 10:109232210-109232232 CAGCTCCCTCCCACTACACGTGG + Intergenic
1074111600 10:110426752-110426774 CAGCCCACTCCCTCCCCAAATGG - Intergenic
1074859255 10:117497897-117497919 AAGCTCACCCTCACCCCTGGAGG + Intergenic
1075727235 10:124616855-124616877 CTGCTCACTCCCAGCCTCGGTGG - Intronic
1075969008 10:126637386-126637408 CAGCCCATTCCCCCACCAGGGGG + Intronic
1077239382 11:1502675-1502697 CAGCTCCCCCACAGCCCAGGTGG + Intergenic
1077734976 11:4781751-4781773 CAGGTCCCTCCCACAACAGGTGG - Intronic
1077797277 11:5505765-5505787 CAGGTCCCTCCCACAACAGGTGG + Intronic
1078352515 11:10606222-10606244 CAGCTCACTCACAACCCCGCTGG + Intronic
1078699789 11:13669087-13669109 TAGCGGCCTCCCACCCCAGGCGG - Intronic
1078898848 11:15622752-15622774 CAGCTCCAACCCAGCCCAGGCGG + Intergenic
1079004741 11:16783650-16783672 CAGGTCACCCTGACCCCAGGTGG - Intronic
1079371222 11:19854526-19854548 CAGCCCACACCCACCCAAAGGGG - Intronic
1079694276 11:23459572-23459594 CAGGTCACTCCCACAGCATGTGG + Intergenic
1080075191 11:28139995-28140017 CAGCTCATTCCTGCCCCATGTGG + Intronic
1080337974 11:31221478-31221500 AAGGTCACTACCACCCCAGTGGG - Intronic
1080531223 11:33178577-33178599 CAGATCCCTCCCACCACACGTGG - Intergenic
1081626584 11:44659628-44659650 CCTCCCACTCCCACCCAAGGAGG - Intergenic
1081630935 11:44689151-44689173 GAGCCCACTCCCTCACCAGGGGG - Intergenic
1081768007 11:45625788-45625810 CAGGTCCCTCCCACGACAGGTGG + Intergenic
1081963173 11:47153151-47153173 CAGCTCCCTCCCCACCCAGATGG - Intronic
1083259218 11:61514170-61514192 CAGCTCAGGCCCAGCACAGGGGG - Intergenic
1083263426 11:61535390-61535412 CGGCCCACCCCCACCCCAAGTGG - Intronic
1083276498 11:61599890-61599912 GAGCTCAGTCCCTCCCCATGTGG - Intergenic
1083324775 11:61867635-61867657 CAGCTGACCCCTACCCAAGGAGG + Intergenic
1083779044 11:64908868-64908890 CAGCTCATGCCCACCCCAGGTGG + Intronic
1083794617 11:65007990-65008012 CAGCTTAGTATCACCCCAGGGGG - Intergenic
1083880792 11:65547368-65547390 CACCCCAGCCCCACCCCAGGTGG + Intronic
1084221287 11:67681351-67681373 CAGGTCACTCCCACCACACATGG + Intergenic
1085008756 11:73120150-73120172 CAGCTCCCTCCCACAACACGTGG + Intronic
1087094368 11:94305683-94305705 CAGCTCGTCCCCAGCCCAGGTGG - Exonic
1087335011 11:96833186-96833208 CAGCTCACTCCTACAACAGATGG - Intergenic
1088531236 11:110811987-110812009 CAGGTCACTCCCACAGCACGTGG + Intergenic
1090255548 11:125281195-125281217 CAGCTCAGAGCCACCTCAGGAGG + Intronic
1090567116 11:128006737-128006759 GAACTCACTCCCATCTCAGGTGG - Intergenic
1090918837 11:131190726-131190748 CAGCCCACTCCCACCCTCAGTGG - Intergenic
1091014409 11:132037170-132037192 GAGCTCACTCACCCCCCAAGAGG - Intronic
1091114327 11:132999242-132999264 CAGATCTCACCCTCCCCAGGTGG + Intronic
1091320560 11:134646596-134646618 GAGCTCAATCCCACCCCTGCAGG + Intergenic
1091344977 11:134846283-134846305 GAGCTCAATCCCACCCCTGCAGG - Intergenic
1091395277 12:150541-150563 CATCACCCTCCCTCCCCAGGTGG - Intronic
1093230753 12:16539060-16539082 CAGCTCTCTCCCACAACATGTGG + Intronic
1093771169 12:23020419-23020441 CAGCTCCCTCCCTCCACATGTGG - Intergenic
1096522680 12:52193080-52193102 CCCCACTCTCCCACCCCAGGGGG + Intergenic
1096606492 12:52769986-52770008 CATGTCACCACCACCCCAGGAGG - Intronic
1096656906 12:53097766-53097788 CTGCTCGCTGCCAGCCCAGGAGG + Exonic
1097100053 12:56581352-56581374 CAGCTGAGTCCCACCTCATGTGG - Intronic
1097277274 12:57822087-57822109 GAGCGCCCTCCCACCCCAGGAGG + Exonic
1097445432 12:59666507-59666529 CAGGTCCCTCCCACAACAGGTGG - Intronic
1098164037 12:67674612-67674634 CAGGTCCCTCCCACAACAGGTGG + Intergenic
1099036138 12:77589689-77589711 CAGTTCCCTCCCACCACATGTGG + Intergenic
1099860701 12:88222375-88222397 CTGCTCTGTGCCACCCCAGGAGG + Intergenic
1100038577 12:90282677-90282699 CAGGTCCCTCCCACCACATGTGG - Intergenic
1100047412 12:90399418-90399440 CAGCTCACTCACATCTCTGGGGG + Intergenic
1100360941 12:93878712-93878734 CAGCTAACGCCCACCCATGGAGG - Intronic
1102453286 12:113056860-113056882 CGGCTCCCTCCCACTCCGGGGGG + Intronic
1102977252 12:117215505-117215527 CAGCTCACTGCAATCCCAGCAGG + Intronic
1103443622 12:120980361-120980383 CAGCCCTCCCCCACCCCAGCTGG - Intronic
1103611905 12:122129253-122129275 CTGCCCACTCCCTCCCTAGGCGG - Intronic
1103881442 12:124169113-124169135 CAGGTCCCTCCCACACCATGTGG - Intronic
1104662325 12:130620297-130620319 CCACTCCCTCCCACCCCAGGCGG + Intronic
1107045053 13:35984933-35984955 CAGGGCACTGCCACACCAGGAGG - Intronic
1110543657 13:76733193-76733215 CAGCTCCCTCCCACAACATGTGG + Intergenic
1111511944 13:89278033-89278055 CAGCTCTCCCCCACCTCAGCTGG - Intergenic
1111691430 13:91567903-91567925 CAGCTCACTCCCTCCACAAGTGG - Intronic
1112194054 13:97207595-97207617 CAGATCCCTCCCACAACAGGTGG + Intergenic
1112616625 13:101013580-101013602 GAACTCACTGCCACCCCAGCAGG + Intergenic
1112618996 13:101035410-101035432 CAGCTCACTCTCACCCACAGAGG - Intergenic
1112789674 13:102989039-102989061 CAGTTCCCTCCCACCACATGGGG + Intergenic
1113071855 13:106429745-106429767 CAGCCCACTCCACCCCCAAGAGG + Intergenic
1113385942 13:109848091-109848113 GAGCTCCCTCCCTCGCCAGGGGG - Intergenic
1114453436 14:22841021-22841043 CATGGCACTCCCATCCCAGGAGG + Intronic
1115007020 14:28498461-28498483 CAGGTCTCTCCCACAACAGGTGG + Intergenic
1115482503 14:33875170-33875192 CAGGTCACTCCCACAGGAGGTGG + Intergenic
1115609352 14:35036512-35036534 CAGGTCACTCCCACAACACGTGG + Intergenic
1117752370 14:58937269-58937291 CAGCTCACTCCCACAACATGTGG + Intergenic
1118566380 14:67145572-67145594 CATCTCATTCCCACTCAAGGAGG - Intronic
1118752911 14:68819544-68819566 AGGCTCACTGCCACCCCAGCCGG - Intergenic
1119723724 14:76909109-76909131 ATGCTCACTTCCTCCCCAGGAGG + Intergenic
1121887927 14:97561743-97561765 CAGCTCCTCCCCACCCCATGTGG + Intergenic
1122544493 14:102514670-102514692 CAGCCCAGTCCCACCACTGGTGG - Intergenic
1122806639 14:104263192-104263214 CAGCTGGCCCCCTCCCCAGGGGG - Intergenic
1122877820 14:104677038-104677060 CAGCTCTCTCACTCCTCAGGCGG - Intergenic
1122913318 14:104844207-104844229 CAGTCCCCTCCCACCCCTGGGGG - Intergenic
1123558004 15:21452304-21452326 CCACTCGCTCCCAGCCCAGGAGG + Intergenic
1123594232 15:21889585-21889607 CCACTCGCTCCCAGCCCAGGAGG + Intergenic
1123945606 15:25237451-25237473 CAGCTCACGGCCAACCAAGGTGG - Intergenic
1124118397 15:26867863-26867885 CCGCGCGCTCCCAGCCCAGGAGG + Intronic
1125044608 15:35231234-35231256 CAGTTGACACCCACCCAAGGAGG - Intronic
1126822663 15:52520241-52520263 CAGCTCACAGCCATCCCATGAGG + Intronic
1127115456 15:55721923-55721945 CAGGTCCCTCCCACCACACGTGG + Intronic
1127794534 15:62426639-62426661 CAGCTCACTCCCAGCACACCCGG - Intronic
1129361953 15:75029788-75029810 TGGCTCCCTCCCTCCCCAGGGGG - Intronic
1129663677 15:77567370-77567392 TAGCTCACGCCCACACCATGTGG + Intergenic
1129701228 15:77769656-77769678 CAGCCCCCACCCACCCCTGGGGG + Intronic
1129831964 15:78676503-78676525 CAACTCCCTCCCACCCCAATGGG + Intronic
1129904010 15:79173226-79173248 CAGCTCATCCCCACATCAGGAGG + Intergenic
1130585102 15:85174445-85174467 CAGCACATTCCCATCCCAGGAGG - Intergenic
1131145645 15:90009828-90009850 CAGCCCACTCTCACTCCAGCTGG + Intronic
1131182436 15:90249741-90249763 CAGCTGAGTCCATCCCCAGGCGG + Exonic
1131712124 15:95067491-95067513 CAGGTCCCTCCCACCACATGTGG + Intergenic
1132178672 15:99734777-99734799 CAGGTCCCTCCCACAACAGGTGG - Intergenic
1132330001 15:101005729-101005751 GGGCTCTCTCCCACCCCAGTGGG + Intronic
1202966356 15_KI270727v1_random:179476-179498 CCACTCGCTCCCAGCCCAGGAGG + Intergenic
1132462461 16:62212-62234 CAGCTCCCTGCCATCCCCGGAGG - Intronic
1132833096 16:1939084-1939106 CAGCCCACACCCACCCCAGACGG - Exonic
1133139604 16:3734495-3734517 CAGCTGAGTTCCACCCCAGGAGG - Intronic
1133236251 16:4388686-4388708 CAGCTCAGGCCCATTCCAGGGGG - Intronic
1134334351 16:13283642-13283664 CAGATCCCTCCCACAACAGGTGG + Intergenic
1134511437 16:14851258-14851280 CCGGTCACTAACACCCCAGGAGG - Intronic
1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG + Intronic
1135380560 16:21992870-21992892 CACCTCCCTCCCTCCACAGGTGG - Intronic
1135393156 16:22110785-22110807 CAGCTCACACCCAGCCCAGAGGG + Intronic
1135538306 16:23311574-23311596 CACCTTACCCCTACCCCAGGAGG + Intronic
1136246233 16:28977842-28977864 CCTCCCACTCCCACCCCAGCTGG - Intronic
1136787212 16:32942014-32942036 CATCAATCTCCCACCCCAGGGGG - Intergenic
1137399737 16:48143588-48143610 CAGGTCCCTCCCACGACAGGTGG - Intronic
1137583019 16:49645724-49645746 CAGGTCCCTCCCACCACAAGTGG - Intronic
1137619713 16:49868319-49868341 CCGCCCATTCCCACCCCAAGAGG + Intergenic
1138139523 16:54556387-54556409 ATGCTCACAACCACCCCAGGAGG - Intergenic
1138247587 16:55479144-55479166 CAGCTCCCTCCCAGCCCAGCCGG + Exonic
1139512630 16:67436176-67436198 AAGCCCTCCCCCACCCCAGGGGG - Intronic
1139696698 16:68680183-68680205 CAGCTGCCTCCCAGCCCTGGAGG - Intronic
1140026186 16:71292417-71292439 CAGCTCTCTCCCACAACATGTGG + Intergenic
1141261344 16:82456656-82456678 CACCACAGTCCCACCTCAGGTGG + Intergenic
1141622887 16:85246671-85246693 CACCCCACTCCCACCCTCGGAGG + Intergenic
1142065481 16:88059936-88059958 CTGCACACACACACCCCAGGAGG + Intronic
1142185139 16:88691375-88691397 CAGCTCCCTCACACGGCAGGTGG - Intergenic
1142245376 16:88967853-88967875 CAGCTCACGCCGACCCCCGCTGG - Intronic
1142366078 16:89650419-89650441 CAGCCCCATCCCACCCCATGGGG + Intronic
1142434159 16:90046696-90046718 AAACTCACTCCCACCCCATCAGG + Intergenic
1142631717 17:1229855-1229877 CAGCTCCCGCCCTCCCCCGGCGG - Intergenic
1143115811 17:4581443-4581465 GAGCCCACTCCCACCTCAGTTGG + Intergenic
1143474640 17:7195713-7195735 CACCTCTCTCCCGCCCCCGGGGG - Intronic
1143514787 17:7414204-7414226 CATGTCACTCCCATCCCTGGGGG - Intronic
1144483395 17:15645708-15645730 CAGCTGCTTCCCTCCCCAGGGGG - Intronic
1144867326 17:18344990-18345012 CAGCTCACCTCCACCCCACCGGG - Intronic
1144915290 17:18719319-18719341 CAGCTGCTTCCCTCCCCAGGGGG + Intronic
1145950324 17:28812293-28812315 CAGCTCACCCCCGCCCCGGGAGG + Intronic
1147198940 17:38786535-38786557 CAGCTCACTGCCACCTGAGCTGG + Intronic
1147311463 17:39598386-39598408 CAGCTCACTCCCACAGCCGCTGG - Intergenic
1147940474 17:44043614-44043636 CAGCTCACTGCAACCTAAGGAGG + Intronic
1149867530 17:60158995-60159017 CCTTTCACTCACACCCCAGGGGG - Intronic
1151612016 17:75182595-75182617 CCGCTCTCTCCCGCCCCCGGCGG - Intergenic
1151766456 17:76135789-76135811 GAGCTCACTCCCTTCCCTGGTGG + Intergenic
1152200157 17:78940815-78940837 TAGCTCTCTCCCTCCCCAGGAGG + Intergenic
1152525806 17:80887651-80887673 CTCCTCTCTCCCACCCCAGAGGG - Intronic
1152593809 17:81228576-81228598 CAGCTCCCTCCTTCCCCAGGAGG - Exonic
1152658865 17:81533194-81533216 GTGCTCACTCCCCTCCCAGGGGG - Intronic
1152738638 17:82009384-82009406 CAGCCCACTCCCACCCTGGAGGG + Intronic
1152749556 17:82056399-82056421 CACCTCACCCCTACCCCAGGCGG - Intronic
1152854701 17:82658174-82658196 CCCCTCATTCCCAGCCCAGGTGG - Intronic
1152986384 18:325323-325345 CAGCACACTCCCACCAAATGAGG + Intronic
1153523890 18:5977386-5977408 CAGCTCCCTCCCTCCCCAAGGGG + Intronic
1153828509 18:8899137-8899159 GAGCCCTCTCCCTCCCCAGGAGG + Intergenic
1155786762 18:29912536-29912558 CAGCTTACTCTCACCCCACTTGG - Intergenic
1155840034 18:30632444-30632466 TGGCTCACTCCCACTCCAGGTGG + Intergenic
1157781037 18:50439403-50439425 CCCCTCATTCCCAGCCCAGGTGG + Intergenic
1157973242 18:52295326-52295348 CAGCTCCCTCCCACAACACGTGG + Intergenic
1159507042 18:69351948-69351970 CAGGTCCCTCCCACAACAGGTGG + Intergenic
1159909461 18:74131593-74131615 CAGCTCACTGCCACCACTCGTGG - Intronic
1160435660 18:78850529-78850551 CAGATCCCTCCCACAACAGGTGG + Intergenic
1160551189 18:79694519-79694541 CCCCACACTCCCACCCCAGCCGG - Intronic
1160551216 18:79694615-79694637 CCCCACACTCCCACCCCAGCCGG - Intronic
1160739063 19:677542-677564 CAACCCCCACCCACCCCAGGAGG - Intronic
1160827026 19:1085341-1085363 CAGCTCCCTCCCACAACACGTGG + Intronic
1160897309 19:1408638-1408660 CAGCTCAAGCCCACCCCCGGCGG - Intronic
1160898860 19:1416676-1416698 CACCTCACTGCCGCTCCAGGTGG - Intronic
1160968966 19:1759077-1759099 CCCCCCACCCCCACCCCAGGTGG + Intronic
1161371492 19:3914460-3914482 CAGGTCACTCCCACAACAGGAGG + Intronic
1161682289 19:5686397-5686419 CAGCTCTGGCCCCCCCCAGGTGG + Exonic
1161698384 19:5782729-5782751 CAGCTCCCTCGTGCCCCAGGAGG + Intergenic
1162315164 19:9934395-9934417 CAACTCCCTCCCAGCCCTGGGGG + Intronic
1162404060 19:10462871-10462893 CTACTCCCTCCCTCCCCAGGTGG + Intronic
1163429580 19:17259240-17259262 AAGCCCACTCCCTCCCCAGCTGG + Intronic
1163497071 19:17652758-17652780 CATCTGACTCCCAGCCCAGAGGG - Intronic
1163539510 19:17899059-17899081 CAGCTCCCTCCCACAACACGTGG - Intergenic
1163620612 19:18357622-18357644 CCACTCACTCCCACCCCACAGGG - Intronic
1164531025 19:29048340-29048362 CTGCTCACTCGTACCCCAAGCGG - Intergenic
1164686873 19:30172487-30172509 CAGCTCACTCCCACCTGTCGTGG - Intergenic
1165800013 19:38543671-38543693 CTTCCCACTCCCGCCCCAGGGGG - Intronic
1165915298 19:39254888-39254910 CAGCCCACACCGACCCCAGATGG - Intergenic
1166185078 19:41134562-41134584 CAGCCCACCCCCAGCCCTGGTGG - Intergenic
1166414877 19:42588242-42588264 CACCTGGGTCCCACCCCAGGTGG + Intronic
1167049152 19:47068120-47068142 TAACTCACAACCACCCCAGGAGG + Intronic
1167123314 19:47531996-47532018 CAGCTCCCTCCCACGCCCAGGGG + Intronic
1167670741 19:50851868-50851890 CAGGCCACTCCCACCAGAGGAGG - Intergenic
1168475041 19:56669411-56669433 CAGCCCTCTCCCCTCCCAGGAGG + Intronic
925022759 2:584901-584923 CAGCCCACTCTCACTTCAGGTGG - Intergenic
925100211 2:1237869-1237891 CAGCTCTCTCCCTCCCCAGGTGG + Exonic
925115867 2:1377932-1377954 CAGGTCCCTCCCACCACAAGTGG - Intronic
925192010 2:1892562-1892584 CACCTCACACCCAGCACAGGCGG + Intronic
926626547 2:15095505-15095527 CAGTTCCCTCCCACCACACGTGG + Intergenic
926926813 2:17995753-17995775 TGGCTCATTCCCACCCCACGTGG - Intronic
926939057 2:18115895-18115917 CAGCTCCCTCCAACACCATGGGG - Intronic
927646218 2:24878675-24878697 CAGCCTTCTCCCACCCAAGGAGG + Intronic
928082122 2:28320742-28320764 CAGCACACTGCCAGCCCTGGAGG - Intronic
928511749 2:32010031-32010053 CGGCTCGCTCCCTCCCCACGCGG + Intronic
928938204 2:36702333-36702355 CCGCTCACTCACACACTAGGGGG + Intronic
929129961 2:38557440-38557462 TAGTTCACTCCCACACCAGCAGG - Intergenic
929666974 2:43840782-43840804 CAGCTCCATCCCACTCCATGGGG + Intronic
930772635 2:55143151-55143173 CATCTTTCTCTCACCCCAGGGGG - Intergenic
930909363 2:56612155-56612177 CAGCTGACTACCACCTAAGGTGG - Intergenic
931343489 2:61425526-61425548 CAGGTGACTCCCACCCAGGGAGG + Intronic
931736624 2:65199951-65199973 AAGCTCCCCCCAACCCCAGGTGG - Intergenic
932112196 2:69011968-69011990 CAGGTCAGTCTCACCCAAGGTGG + Intergenic
934529056 2:95074002-95074024 CACCCCACTCCCACCCCACTCGG + Intergenic
934797595 2:97114064-97114086 CCACTCACTCCCACCCCAGCCGG - Intronic
935171603 2:100614719-100614741 CTGCTCTGTCCCACCCCAGCAGG + Intergenic
935224182 2:101038795-101038817 CTGCTCACCCCCACCACAAGGGG + Intronic
935723912 2:106006625-106006647 CAGGTCCCTCCCACAACAGGTGG - Intergenic
935744244 2:106176891-106176913 CAGCTCTCTGCAACCCCAGCTGG + Intronic
936664698 2:114580874-114580896 CAGCTCACTGCCATCTCAGCTGG + Intronic
936845141 2:116821798-116821820 TAGCACACCCCCACCCCAAGGGG + Intergenic
936846745 2:116843543-116843565 CAGATCCCTCCCACACCATGTGG + Intergenic
937475824 2:122214363-122214385 CAGCTCCCTCCCACAACAGATGG - Intergenic
940554506 2:155206232-155206254 CAGGTCCCTCCCACAACAGGGGG + Intergenic
941554033 2:166953278-166953300 CAGGTCCCTCCCACCACACGAGG - Intronic
941848827 2:170158848-170158870 CAGCTCATTGCCTCCCCAGCTGG - Intergenic
942078630 2:172380144-172380166 CAGGTCCCTCCCACCACATGTGG + Intergenic
942227560 2:173830534-173830556 CAGCCCACTCCCCTCCCTGGTGG - Intergenic
944399706 2:199311359-199311381 CAGCGCACCCCCACCACAGCAGG + Intronic
947117806 2:226791059-226791081 GAGCTCCCTCACAGCCCAGGAGG + Intronic
947405376 2:229770706-229770728 CAGGTCATTCCCACAGCAGGTGG - Intronic
948359801 2:237412233-237412255 CAGCGCCCTCCACCCCCAGGAGG + Intronic
948664093 2:239523785-239523807 CTCCTCACTACCACCCCAGGTGG + Intergenic
948806212 2:240454344-240454366 CAGTGCACCCTCACCCCAGGAGG + Intronic
1170580862 20:17698532-17698554 CAGCTCCCTCCCTGCTCAGGTGG - Intronic
1170732249 20:18985402-18985424 CAGCTCCCTCACTCCTCAGGTGG - Intergenic
1170803572 20:19610755-19610777 CAGCTCTCTGACCCCCCAGGTGG - Intronic
1170860871 20:20102359-20102381 CAGCTCCCTCACTCCTCAGGTGG + Intronic
1171416094 20:24981510-24981532 CTGCTCTCTCCCTCCCCAGCGGG + Intronic
1172061894 20:32192060-32192082 CTGCTCACTCCCACACAAAGGGG + Intergenic
1172648096 20:36483998-36484020 CACCTAACTCCCAGCCCTGGAGG + Intronic
1172813128 20:37664933-37664955 CAGCTCACTCCCACAACACATGG + Intergenic
1173450473 20:43159202-43159224 CAGCTCCCTCACCCCTCAGGTGG - Intronic
1173457842 20:43217659-43217681 CAGCTCCCGCACACCTCAGGTGG - Intergenic
1173806022 20:45925843-45925865 CAGCTCAAGCCCAGCCTAGGCGG + Intergenic
1174130516 20:48340705-48340727 AAGCCCCCTCCCACCCCACGAGG - Intergenic
1174378507 20:50141722-50141744 CAGGTCTCTCCCATCCCTGGGGG + Intronic
1175543092 20:59760411-59760433 CAGGTCCCTCCCACCACACGTGG - Intronic
1175762108 20:61568232-61568254 CGGCTCCCTCCCACCACATGTGG - Intronic
1176066200 20:63197300-63197322 CAGCTCACTCCCACGCCAAGGGG + Intronic
1176198318 20:63848062-63848084 CACCCCACCTCCACCCCAGGAGG + Intergenic
1176373174 21:6074633-6074655 CAGGTCACCCCTACCCCAGGAGG + Intergenic
1177578477 21:22989006-22989028 CAGGTCTCTCCCACAACAGGTGG - Intergenic
1178761962 21:35411658-35411680 CAGCACACACCCAGCGCAGGTGG - Intronic
1179565129 21:42242879-42242901 CTGCTCACTCAGACCCCCGGGGG - Intronic
1179750303 21:43463610-43463632 CAGGTCGCCCCTACCCCAGGAGG - Intergenic
1180352920 22:11818871-11818893 CAGCTCACCCCCAGCTCTGGGGG + Intergenic
1180385320 22:12173486-12173508 CAGCTCACCCCCAGCTCTGGGGG - Intergenic
1180702060 22:17786646-17786668 CAGTTCACAGCCACCTCAGGTGG - Intergenic
1181236645 22:21451066-21451088 CTGCCCTCTCCCACCCCGGGGGG + Exonic
1181794074 22:25291132-25291154 CAGGTCCCTCCCACCACAGGTGG - Intergenic
1181834073 22:25587682-25587704 CAGGTCCCTCCCACCACAGGTGG - Intronic
1182048855 22:27298120-27298142 CAGCCCACTCCCACCCCAGCTGG + Intergenic
1182050393 22:27308711-27308733 CAGCTCCCTCACTCCTCAGGTGG + Intergenic
1182078171 22:27509323-27509345 CAGCTCCCTCCCCACTCAGGTGG - Intergenic
1182286963 22:29254349-29254371 CAGGCCAGTTCCACCCCAGGAGG - Intronic
1183365814 22:37406378-37406400 CAGCTCAATCACACCCCAGAGGG + Intronic
1183950114 22:41348008-41348030 CAGCTCACCCCCTTCCCAGGTGG + Intronic
1184189476 22:42885377-42885399 TATCTCTCACCCACCCCAGGGGG - Intronic
1184214987 22:43060626-43060648 CAGCCCCATCCCAGCCCAGGAGG - Intronic
1184286276 22:43473506-43473528 CAGGTCACTCTCGGCCCAGGAGG + Intronic
1184566746 22:45296634-45296656 CAGTACACTCCCACTCCAGCAGG + Intergenic
1184835337 22:47017583-47017605 CACCTCACTCCCTCCCCACCTGG - Intronic
1184860163 22:47169024-47169046 CCGCTCACTCCTGCCCCGGGCGG - Intronic
949280606 3:2342534-2342556 CGGCTCCCTCCCACGACAGGTGG - Intronic
950943214 3:16915942-16915964 CAACTCGCTCACACCTCAGGAGG + Intronic
951724626 3:25743405-25743427 AACCTCACTCCCACCTCAGGAGG + Intronic
951819477 3:26791861-26791883 CAGCTGACACCCACCCATGGAGG - Intergenic
953211401 3:40878199-40878221 CAACTCCCTTCCAGCCCAGGAGG - Intergenic
953661473 3:44894306-44894328 CAGCTCTCTCCCACCCCCCATGG + Intronic
953918483 3:46935782-46935804 GAGCTCACTCCCACCCAATGGGG + Intronic
954278182 3:49555782-49555804 CACCTCCCTCCCACCCCCTGGGG - Intronic
954751588 3:52817161-52817183 CAGCTCCCTCCCTCATCAGGAGG + Intronic
955059395 3:55482792-55482814 CAGCCCACTCCCTCCCCTGGAGG - Intronic
955468784 3:59264403-59264425 CAGCTCCCTCCCACAACATGTGG - Intergenic
955771668 3:62390753-62390775 CAGCTCTCTCACTCCTCAGGAGG + Intergenic
955852358 3:63234313-63234335 CAGGTCTCTCCCACCACACGTGG + Intronic
956713768 3:72060706-72060728 CAGATCCCTCCCACACCACGTGG + Intergenic
956989646 3:74748553-74748575 CAGCTCCCTCCTTCCTCAGGTGG - Intergenic
958710475 3:97711059-97711081 CAGCTCCCTCCCACAACACGTGG - Intronic
959033181 3:101327286-101327308 CAGGTCCCTCCCACCACAGTGGG - Intronic
959409144 3:105998318-105998340 CAGCTGACACCCACCCATGGAGG - Intergenic
961530309 3:127536456-127536478 CCGCTCACCCCCACCCCACCTGG - Intergenic
962699135 3:137979670-137979692 CAGCTGACACCCACCCATGGAGG - Intergenic
962951130 3:140219939-140219961 CATATCACTTCAACCCCAGGAGG + Intronic
964943060 3:162185229-162185251 CAGGTCCCTCCCACAACAGGTGG - Intergenic
966942908 3:184758189-184758211 CAGCTCCATCCTCCCCCAGGAGG + Intergenic
967595637 3:191324434-191324456 CAGGTCCCTCCCACCACATGTGG - Intronic
967609281 3:191484058-191484080 CAGCTCCCTCCCACAACATGTGG - Intergenic
967811640 3:193765819-193765841 CAGCTCACTCCCACCCCAGGGGG - Intergenic
968577015 4:1371754-1371776 CAGCTCCCTCCCACCACGTGTGG + Intronic
968814702 4:2815799-2815821 CAGCTCAGACCCAGCCCAGGGGG - Intronic
969655478 4:8495248-8495270 CAGGTCACTAACACCCCATGGGG - Intergenic
969719972 4:8888225-8888247 CAGCTCACCCCCAACCCTTGAGG + Intergenic
971072056 4:23105386-23105408 CAGGTCTCTCCCACAACAGGTGG - Intergenic
972137479 4:35909393-35909415 CAGGTCACTCCCACAACATGTGG - Intergenic
972982531 4:44723796-44723818 GGGCCCACTCCCACCCCATGGGG - Intronic
973960765 4:56107606-56107628 CAGCTCATTGCCACTCCATGGGG - Intergenic
974469653 4:62302331-62302353 CAGCACACTCCCACCTGTGGTGG + Intergenic
974601644 4:64090258-64090280 CAGCTCCCTCCCACAACATGTGG - Intergenic
977861548 4:101966852-101966874 CATCTGACTCCCACCCAAGGAGG + Intronic
980273897 4:130623054-130623076 CAGGTCCCTCCCACCACACGTGG - Intergenic
980846823 4:138333855-138333877 CAGGTCACTCCCACAACATGTGG + Intergenic
982176023 4:152706349-152706371 CAGCTCATTTCCACCCTAGATGG - Intronic
983460840 4:168024047-168024069 CAGCTCCCTCCCACAACACGTGG + Intergenic
984739077 4:183141502-183141524 CACCCTACTACCACCCCAGGAGG + Intronic
985570755 5:643584-643606 CAGCTCACTGCCACCAGGGGAGG - Intronic
985973263 5:3393766-3393788 CAGCTCCCTCCGGCCCCAAGTGG + Intergenic
985982787 5:3486175-3486197 CAACTCCCTCCCACAACAGGTGG + Intergenic
986770681 5:10970058-10970080 CAGCTCACCTCCACCTCAGACGG - Intergenic
987562259 5:19539811-19539833 CAGCTCCCTCCCACAACATGTGG + Intronic
988327435 5:29788083-29788105 CAGGTCCCTCCCACACCATGTGG - Intergenic
988346856 5:30047878-30047900 CAGCTTCCTCCCACAACAGGTGG + Intergenic
988442694 5:31250370-31250392 TGGCTCACTCCGAGCCCAGGGGG - Intronic
988450112 5:31333652-31333674 CAGGTCCCTCCCACCACATGTGG - Intergenic
988604611 5:32668713-32668735 CAGCTCACTCCCACCCGCCATGG + Intergenic
988866824 5:35344188-35344210 CAGGTCCCTCCCACAACAGGTGG + Intergenic
989494872 5:42100883-42100905 CAGGTCCCTCCCACCACATGTGG - Intergenic
991632373 5:68669255-68669277 CAGAGCACTCCCACCTCATGAGG + Intergenic
991980282 5:72223356-72223378 AACCTGACTCCCACCCCAGGTGG - Intronic
994548852 5:101205813-101205835 CAGTTCCCTCCCACAACAGGTGG - Intergenic
995541853 5:113193351-113193373 CTGCCCACCCCCACCCCAAGAGG - Intronic
998058039 5:139096209-139096231 CAGCTGACGCCCACCCATGGAGG + Intronic
998162554 5:139821799-139821821 CAGCACACACCCACTCTAGGGGG - Intronic
999375112 5:151081133-151081155 TCGCTCGGTCCCACCCCAGGCGG - Intronic
999431792 5:151531268-151531290 CAGCTCAGGCCCAGCGCAGGAGG - Intronic
1000315842 5:160089776-160089798 CAGTTTACTCCCACTCCAAGGGG + Intronic
1000356987 5:160407104-160407126 CAGCTCATCTCCACCCCATGTGG - Intronic
1001965384 5:175906553-175906575 CAGCCCACTCCCGCCCCTGCAGG - Intergenic
1002251565 5:177932641-177932663 CAGCCCACTCCCGCCCCTGCAGG + Intergenic
1002541018 5:179906964-179906986 CAGGCCACTCCCTCCGCAGGTGG - Intronic
1002599352 5:180345451-180345473 CTGCCTACTCCCACCCCAGCGGG - Intronic
1003334815 6:5160401-5160423 CAGGTCCCTCCCACCACACGTGG - Intronic
1003463528 6:6354310-6354332 CAGCTCACTCTCACCTGAGAGGG + Intergenic
1005650322 6:27879561-27879583 GAGCGCCCTCCCACCCCAGGAGG + Intergenic
1006335379 6:33417857-33417879 CATTTCACTCACACCTCAGGGGG + Intronic
1006428126 6:33978812-33978834 GGGTTCTCTCCCACCCCAGGCGG - Intergenic
1006840989 6:37027820-37027842 CAGCCCACCCCCAACCCATGGGG + Intronic
1006844624 6:37053757-37053779 CATCTCCCTCCCACCCTAGGTGG - Intergenic
1006984546 6:38168108-38168130 CAGCTCCCTCCCACCTCCTGTGG - Intergenic
1007253993 6:40515957-40515979 CTGCTCACTCACTCCTCAGGTGG + Intronic
1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG + Intronic
1007703556 6:43778070-43778092 CAGCTCCCTCCCACCCTATCTGG - Intronic
1007963660 6:45984286-45984308 CAGCAGACTCCCAGGCCAGGAGG - Intronic
1008537107 6:52514776-52514798 CAGTTCATGCCCACCCCCGGAGG - Intronic
1008825040 6:55683988-55684010 CGGGTCCCTCCCACCACAGGTGG - Intergenic
1010027186 6:71232946-71232968 CAGGTCCCTCCCACAACAGGTGG - Intergenic
1011271190 6:85581067-85581089 CAGCACACTCCTACTCCTGGTGG + Intronic
1011384655 6:86782043-86782065 CAGGTCATTCCCAGCCCAAGGGG + Intergenic
1011876664 6:91970994-91971016 CAGGTCACTCCCACAACAGGTGG + Intergenic
1012106677 6:95170043-95170065 CAGCTCCCTCCCTTCCCAAGAGG - Intergenic
1012410284 6:98948128-98948150 CAGCCCGCTCCCAGGCCAGGGGG + Intergenic
1013137967 6:107300518-107300540 CAGCTCACACCCAACCCATCAGG + Intronic
1013401595 6:109802026-109802048 CAGCTAATTCCCTCCACAGGCGG + Intronic
1014773762 6:125485827-125485849 CAGGTCCCTCCCACCACATGTGG + Intergenic
1015022925 6:128498385-128498407 CAGCTCCCTCCAACCCATGGGGG + Intronic
1016568475 6:145485974-145485996 CAGGTCCCTCCCACCACATGTGG + Intergenic
1017647784 6:156555096-156555118 CACCTCACTGCCACCCCCGAGGG + Intergenic
1018058674 6:160072872-160072894 CAGCACTCACCCACGCCAGGAGG - Exonic
1018396717 6:163383479-163383501 CAGGTCCCTCCCACAACAGGAGG - Intergenic
1019134561 6:169899945-169899967 GAGGGCACTCCGACCCCAGGCGG - Intergenic
1019280999 7:200217-200239 CCCCTCCCACCCACCCCAGGTGG + Intronic
1019293287 7:260876-260898 CAGCCCCCTCCGACCCCAGCAGG - Intergenic
1019497169 7:1346047-1346069 CAGCTTCCTCCAACCCCAGTGGG - Intergenic
1019677575 7:2323874-2323896 CGGCTCACTGCAACCTCAGGTGG + Intronic
1022107037 7:27204120-27204142 CCTCTCTCTCCCACCCTAGGTGG + Intergenic
1022234140 7:28444987-28445009 CAGCTCCCTCCCACCACATATGG - Intronic
1022349438 7:29553821-29553843 CAGGTCCCTCCCACCACATGTGG + Intergenic
1026224760 7:68430591-68430613 CAGGTCCCTCCCACCACATGTGG - Intergenic
1026335262 7:69388958-69388980 CATCTCACCCTCTCCCCAGGAGG + Intergenic
1026541505 7:71283635-71283657 CAGGTCCCTCCCACAACAGGTGG - Intronic
1026644623 7:72156750-72156772 CAGAGCACTCCCACCACGGGAGG - Intronic
1028139155 7:87253897-87253919 CAGCTCCCTCCCACAACATGTGG + Intergenic
1029181386 7:98704406-98704428 CAGCTCCCTCCCACCCGGGTGGG + Intergenic
1029437208 7:100569987-100570009 CACCTCACCCCCACCCCTGCTGG + Intergenic
1029617784 7:101670512-101670534 CAGGTCCCTCCCACAACAGGAGG + Intergenic
1030733072 7:113012917-113012939 CAGGTCACTCCCACAACATGTGG - Intergenic
1030734496 7:113030445-113030467 CAGCTCCCTCCCACAACATGTGG + Intergenic
1031356422 7:120792343-120792365 CCGGTCCCTCCCTCCCCAGGAGG + Intronic
1032971914 7:137174648-137174670 CAGCTGACGCCCTCCCCTGGAGG + Intergenic
1033227167 7:139571336-139571358 CAGCCGTCTCCCGCCCCAGGCGG - Exonic
1033270854 7:139931714-139931736 CAGGTCCCTCCCACCACACGTGG + Intronic
1033540239 7:142349599-142349621 CAGCCGACTCCAACCCCAGCAGG - Intergenic
1034045970 7:147927973-147927995 CAGGTCCCTCCCACCACATGTGG - Intronic
1034533696 7:151713653-151713675 CAGCTCACTACAACCTCAGGAGG + Intronic
1035616728 8:1007467-1007489 CAGCTGACTTACATCCCAGGAGG + Intergenic
1035741756 8:1933624-1933646 AAGCTGACACCCACCCCAGTTGG - Intronic
1035820041 8:2580868-2580890 CTGCACACTCCCACCACAAGCGG - Intergenic
1038072043 8:24028015-24028037 CAGCTCCCACCCACCTCAGGTGG - Intergenic
1039922537 8:41903521-41903543 CTGCACTCTCCCACCCAAGGTGG + Intergenic
1040077043 8:43246956-43246978 CCGCTCAATCCCATCCCCGGTGG + Intergenic
1041153327 8:54958290-54958312 AAGCTCACTCCCAGCCCACTGGG - Intergenic
1042057853 8:64786071-64786093 CAGGTCCCTCCCACCACATGGGG + Intronic
1043665092 8:82800336-82800358 CAGGTCACTCTCACCACACGTGG + Intergenic
1044092724 8:88022329-88022351 CAGGTCCCTCCCACCACATGTGG - Intergenic
1044743468 8:95350710-95350732 CAGCTCCCTCACCACCCAGGTGG - Intergenic
1044953426 8:97455528-97455550 CAGCTTCCTCCCACGACAGGTGG + Intergenic
1045192102 8:99893367-99893389 CAGCTCACTCCGAAGCCAGCTGG + Intronic
1046882087 8:119320372-119320394 CAGGTCCCTCCCACAACAGGTGG + Intergenic
1047302711 8:123627821-123627843 CAGCTCACTCTTACAGCAGGAGG - Intergenic
1048743857 8:137591644-137591666 CAGCTCCCTCCCAGCCCTGAGGG - Intergenic
1049465205 8:142748114-142748136 CAGGCCACTCCCACCCCTGGCGG - Intergenic
1049579015 8:143402500-143402522 CAGCACACTCTCACCACACGGGG - Intergenic
1050890434 9:10818539-10818561 CACCTCCCTCCCTCACCAGGTGG + Intergenic
1051199189 9:14597964-14597986 CAGCTCACTGCCACCGCAACTGG + Intergenic
1053199636 9:36143659-36143681 CCTCTCACTCCTACCCCAGCAGG + Intronic
1053428729 9:38027896-38027918 CAGCTCCATCCCTCTCCAGGAGG - Intronic
1059841920 9:118227059-118227081 TAGCTCAGTCCCTCTCCAGGAGG - Intergenic
1061233434 9:129328227-129328249 CAGAGCACTCCCAACCCAGGAGG - Intergenic
1061639173 9:131937894-131937916 CAGCTCACTGCAACCTCTGGAGG + Intronic
1061869474 9:133513149-133513171 CAGCTATCTCCCAGCCCTGGAGG + Intergenic
1062125410 9:134858090-134858112 CTGCTCACTGCCACCCCACTTGG + Intergenic
1062253848 9:135611703-135611725 CAGCCTCCTCCCACCCCAGATGG + Intergenic
1062372990 9:136249639-136249661 GAGCTCACTCACTGCCCAGGCGG - Intergenic
1062480421 9:136748364-136748386 CAGCTCTCCCCACCCCCAGGAGG + Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1185825926 X:3249695-3249717 CAGGTCCCTCCCACAACAGGTGG + Intergenic
1187098535 X:16169913-16169935 GACCTCACCCCCACCCCAAGGGG - Intronic
1187225390 X:17371350-17371372 CCTCTCTCTCCCACACCAGGAGG - Intergenic
1188427628 X:30067529-30067551 CAGCTGCCACCCACCCAAGGAGG + Intergenic
1189320309 X:40083541-40083563 AAGTTCACTCCCAGCCCAGGTGG - Intronic
1189674459 X:43446820-43446842 CAGCTCCCTCCCACAACACGTGG - Intergenic
1190269543 X:48852108-48852130 CAGGTCTCTCCCACAACAGGTGG + Intergenic
1190463566 X:50703540-50703562 CAGGTCACTCCCTCCACATGTGG - Intronic
1191059440 X:56278882-56278904 CTGCTGACTCCCACCCATGGAGG - Intronic
1191149974 X:57209909-57209931 CAGCTGACACCCACCCATGGAGG - Intergenic
1192239709 X:69319442-69319464 CAGCTGACTCAGACCCCTGGGGG - Intergenic
1193195784 X:78630396-78630418 CAGGTCCCTCCCACCACAGGAGG - Intergenic
1193568308 X:83107697-83107719 CAGCTCACTCTCACCCAGGCTGG - Intergenic
1193950071 X:87786576-87786598 CAGGTCCCTCCCACAACAGGTGG + Intergenic
1197572183 X:128163287-128163309 CAGCTCCCACACACCCCAGAAGG + Intergenic
1197736452 X:129852844-129852866 CAGATTACCCCCACCCCAGCAGG - Intergenic
1197765398 X:130056739-130056761 CACCTCACCCCCTCCCCAGTGGG - Exonic
1197971512 X:132119858-132119880 CAGTTCATTTACACCCCAGGAGG - Intronic
1198433418 X:136590774-136590796 CATATCACACCCACCCCAGAGGG - Intergenic
1198611880 X:138411051-138411073 CAGCTGACACCCACCCATGGAGG + Intergenic
1198996224 X:142577239-142577261 CAGGTCCCTCCCACCACATGTGG - Intergenic
1199147608 X:144387752-144387774 CAGCTCCCTCCCACAACATGCGG + Intergenic
1199848901 X:151711360-151711382 CAGCTCGCTACCTCCCAAGGGGG - Intergenic
1199909776 X:152272719-152272741 CAGTTCCCTCCCACCACACGTGG - Intronic
1200089388 X:153627221-153627243 CACCCCACTTCCACCGCAGGAGG + Intergenic