ID: 967812673

View in Genome Browser
Species Human (GRCh38)
Location 3:193773839-193773861
Sequence ACTCAATCCACACTCTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967812672_967812673 10 Left 967812672 3:193773806-193773828 CCTAACTTCATTACTTCATTTAT No data
Right 967812673 3:193773839-193773861 ACTCAATCCACACTCTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967812673 Original CRISPR ACTCAATCCACACTCTATGT AGG Intergenic
No off target data available for this crispr