ID: 967819274

View in Genome Browser
Species Human (GRCh38)
Location 3:193826160-193826182
Sequence CTGTGGAGAAGAACCAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967819274_967819277 -6 Left 967819274 3:193826160-193826182 CCATGCTTGGTTCTTCTCCACAG No data
Right 967819277 3:193826177-193826199 CCACAGCGTCTTTGTTTAGTGGG No data
967819274_967819275 -7 Left 967819274 3:193826160-193826182 CCATGCTTGGTTCTTCTCCACAG No data
Right 967819275 3:193826176-193826198 TCCACAGCGTCTTTGTTTAGTGG No data
967819274_967819282 29 Left 967819274 3:193826160-193826182 CCATGCTTGGTTCTTCTCCACAG No data
Right 967819282 3:193826212-193826234 ACTGAAATCCCTGCAATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967819274 Original CRISPR CTGTGGAGAAGAACCAAGCA TGG (reversed) Intergenic
No off target data available for this crispr