ID: 967820034

View in Genome Browser
Species Human (GRCh38)
Location 3:193831804-193831826
Sequence TACAATTGGCTCCACGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967820034_967820042 21 Left 967820034 3:193831804-193831826 CCAGTACCGTGGAGCCAATTGTA No data
Right 967820042 3:193831848-193831870 CTGCCTTGCCAGCTGCGTGTGGG No data
967820034_967820038 -4 Left 967820034 3:193831804-193831826 CCAGTACCGTGGAGCCAATTGTA No data
Right 967820038 3:193831823-193831845 TGTACGTCTCATTCAGCCTCGGG No data
967820034_967820037 -5 Left 967820034 3:193831804-193831826 CCAGTACCGTGGAGCCAATTGTA No data
Right 967820037 3:193831822-193831844 TTGTACGTCTCATTCAGCCTCGG No data
967820034_967820041 20 Left 967820034 3:193831804-193831826 CCAGTACCGTGGAGCCAATTGTA No data
Right 967820041 3:193831847-193831869 CCTGCCTTGCCAGCTGCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967820034 Original CRISPR TACAATTGGCTCCACGGTAC TGG (reversed) Intergenic
No off target data available for this crispr