ID: 967820401

View in Genome Browser
Species Human (GRCh38)
Location 3:193834372-193834394
Sequence ACCGTTCTAAGGAAGCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967820401_967820405 2 Left 967820401 3:193834372-193834394 CCTGGGAGCTTCCTTAGAACGGT No data
Right 967820405 3:193834397-193834419 CTTGCATCTCCTGCACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967820401 Original CRISPR ACCGTTCTAAGGAAGCTCCC AGG (reversed) Intergenic