ID: 967820402

View in Genome Browser
Species Human (GRCh38)
Location 3:193834383-193834405
Sequence AGATGCAAGGGACCGTTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967820402_967820405 -9 Left 967820402 3:193834383-193834405 CCTTAGAACGGTCCCTTGCATCT No data
Right 967820405 3:193834397-193834419 CTTGCATCTCCTGCACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967820402 Original CRISPR AGATGCAAGGGACCGTTCTA AGG (reversed) Intergenic
No off target data available for this crispr