ID: 967820402 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:193834383-193834405 |
| Sequence | AGATGCAAGGGACCGTTCTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 967820402_967820405 | -9 | Left | 967820402 | 3:193834383-193834405 | CCTTAGAACGGTCCCTTGCATCT | No data | ||
| Right | 967820405 | 3:193834397-193834419 | CTTGCATCTCCTGCACCCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 967820402 | Original CRISPR | AGATGCAAGGGACCGTTCTA AGG (reversed) | Intergenic | ||