ID: 967820405

View in Genome Browser
Species Human (GRCh38)
Location 3:193834397-193834419
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967820402_967820405 -9 Left 967820402 3:193834383-193834405 CCTTAGAACGGTCCCTTGCATCT No data
Right 967820405 3:193834397-193834419 CTTGCATCTCCTGCACCCCCAGG No data
967820399_967820405 11 Left 967820399 3:193834363-193834385 CCTTTGGAACCTGGGAGCTTCCT No data
Right 967820405 3:193834397-193834419 CTTGCATCTCCTGCACCCCCAGG No data
967820401_967820405 2 Left 967820401 3:193834372-193834394 CCTGGGAGCTTCCTTAGAACGGT No data
Right 967820405 3:193834397-193834419 CTTGCATCTCCTGCACCCCCAGG No data
967820395_967820405 30 Left 967820395 3:193834344-193834366 CCAGGAAAGCACTGCTGCTCCTT No data
Right 967820405 3:193834397-193834419 CTTGCATCTCCTGCACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type