ID: 967821374

View in Genome Browser
Species Human (GRCh38)
Location 3:193842356-193842378
Sequence GGCTCCACACAGAGGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967821363_967821374 7 Left 967821363 3:193842326-193842348 CCAGAGCCCTGTGGCCAGGGTCC No data
Right 967821374 3:193842356-193842378 GGCTCCACACAGAGGGGACAGGG No data
967821364_967821374 1 Left 967821364 3:193842332-193842354 CCCTGTGGCCAGGGTCCTGCTGA No data
Right 967821374 3:193842356-193842378 GGCTCCACACAGAGGGGACAGGG No data
967821365_967821374 0 Left 967821365 3:193842333-193842355 CCTGTGGCCAGGGTCCTGCTGAG No data
Right 967821374 3:193842356-193842378 GGCTCCACACAGAGGGGACAGGG No data
967821368_967821374 -7 Left 967821368 3:193842340-193842362 CCAGGGTCCTGCTGAGGGCTCCA No data
Right 967821374 3:193842356-193842378 GGCTCCACACAGAGGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967821374 Original CRISPR GGCTCCACACAGAGGGGACA GGG Intergenic
No off target data available for this crispr