ID: 967822512

View in Genome Browser
Species Human (GRCh38)
Location 3:193851328-193851350
Sequence CCTTTTATCCTGGAGCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967822502_967822512 -4 Left 967822502 3:193851309-193851331 CCCAAGGCCCCCCCAAAAGCCTT No data
Right 967822512 3:193851328-193851350 CCTTTTATCCTGGAGCTGCTAGG No data
967822503_967822512 -5 Left 967822503 3:193851310-193851332 CCAAGGCCCCCCCAAAAGCCTTT No data
Right 967822512 3:193851328-193851350 CCTTTTATCCTGGAGCTGCTAGG No data
967822498_967822512 25 Left 967822498 3:193851280-193851302 CCAGTGGGAAGTTGGGGCTGCGT No data
Right 967822512 3:193851328-193851350 CCTTTTATCCTGGAGCTGCTAGG No data
967822501_967822512 -3 Left 967822501 3:193851308-193851330 CCCCAAGGCCCCCCCAAAAGCCT No data
Right 967822512 3:193851328-193851350 CCTTTTATCCTGGAGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967822512 Original CRISPR CCTTTTATCCTGGAGCTGCT AGG Intergenic
No off target data available for this crispr