ID: 967826491

View in Genome Browser
Species Human (GRCh38)
Location 3:193881707-193881729
Sequence CACAGAAGGTGGCCCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967826491_967826496 2 Left 967826491 3:193881707-193881729 CCTGCCCTGGGCCACCTTCTGTG No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data
967826491_967826505 22 Left 967826491 3:193881707-193881729 CCTGCCCTGGGCCACCTTCTGTG No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826491_967826497 3 Left 967826491 3:193881707-193881729 CCTGCCCTGGGCCACCTTCTGTG No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967826491 Original CRISPR CACAGAAGGTGGCCCAGGGC AGG (reversed) Intergenic
No off target data available for this crispr