ID: 967826496

View in Genome Browser
Species Human (GRCh38)
Location 3:193881732-193881754
Sequence GACCCCTCCTCACCCCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967826493_967826496 -3 Left 967826493 3:193881712-193881734 CCTGGGCCACCTTCTGTGTAGAC No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data
967826491_967826496 2 Left 967826491 3:193881707-193881729 CCTGCCCTGGGCCACCTTCTGTG No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data
967826490_967826496 6 Left 967826490 3:193881703-193881725 CCATCCTGCCCTGGGCCACCTTC No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data
967826494_967826496 -9 Left 967826494 3:193881718-193881740 CCACCTTCTGTGTAGACCCCTCC No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data
967826484_967826496 25 Left 967826484 3:193881684-193881706 CCTCACCCCTCTAGTTCTGCCAT No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data
967826487_967826496 18 Left 967826487 3:193881691-193881713 CCTCTAGTTCTGCCATCCTGCCC No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data
967826485_967826496 20 Left 967826485 3:193881689-193881711 CCCCTCTAGTTCTGCCATCCTGC No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data
967826492_967826496 -2 Left 967826492 3:193881711-193881733 CCCTGGGCCACCTTCTGTGTAGA No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data
967826486_967826496 19 Left 967826486 3:193881690-193881712 CCCTCTAGTTCTGCCATCCTGCC No data
Right 967826496 3:193881732-193881754 GACCCCTCCTCACCCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967826496 Original CRISPR GACCCCTCCTCACCCCACTG AGG Intergenic
No off target data available for this crispr