ID: 967826497

View in Genome Browser
Species Human (GRCh38)
Location 3:193881733-193881755
Sequence ACCCCTCCTCACCCCACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967826490_967826497 7 Left 967826490 3:193881703-193881725 CCATCCTGCCCTGGGCCACCTTC No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data
967826493_967826497 -2 Left 967826493 3:193881712-193881734 CCTGGGCCACCTTCTGTGTAGAC No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data
967826486_967826497 20 Left 967826486 3:193881690-193881712 CCCTCTAGTTCTGCCATCCTGCC No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data
967826491_967826497 3 Left 967826491 3:193881707-193881729 CCTGCCCTGGGCCACCTTCTGTG No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data
967826487_967826497 19 Left 967826487 3:193881691-193881713 CCTCTAGTTCTGCCATCCTGCCC No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data
967826494_967826497 -8 Left 967826494 3:193881718-193881740 CCACCTTCTGTGTAGACCCCTCC No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data
967826484_967826497 26 Left 967826484 3:193881684-193881706 CCTCACCCCTCTAGTTCTGCCAT No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data
967826492_967826497 -1 Left 967826492 3:193881711-193881733 CCCTGGGCCACCTTCTGTGTAGA No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data
967826485_967826497 21 Left 967826485 3:193881689-193881711 CCCCTCTAGTTCTGCCATCCTGC No data
Right 967826497 3:193881733-193881755 ACCCCTCCTCACCCCACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967826497 Original CRISPR ACCCCTCCTCACCCCACTGA GGG Intergenic
No off target data available for this crispr