ID: 967826505

View in Genome Browser
Species Human (GRCh38)
Location 3:193881752-193881774
Sequence AGGGTCTGAGTCTCCGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967826492_967826505 18 Left 967826492 3:193881711-193881733 CCCTGGGCCACCTTCTGTGTAGA No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826493_967826505 17 Left 967826493 3:193881712-193881734 CCTGGGCCACCTTCTGTGTAGAC No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826491_967826505 22 Left 967826491 3:193881707-193881729 CCTGCCCTGGGCCACCTTCTGTG No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826495_967826505 8 Left 967826495 3:193881721-193881743 CCTTCTGTGTAGACCCCTCCTCA No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826499_967826505 -6 Left 967826499 3:193881735-193881757 CCCTCCTCACCCCACTGAGGGTC No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826490_967826505 26 Left 967826490 3:193881703-193881725 CCATCCTGCCCTGGGCCACCTTC No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826494_967826505 11 Left 967826494 3:193881718-193881740 CCACCTTCTGTGTAGACCCCTCC No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826501_967826505 -10 Left 967826501 3:193881739-193881761 CCTCACCCCACTGAGGGTCTGAG No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826500_967826505 -7 Left 967826500 3:193881736-193881758 CCTCCTCACCCCACTGAGGGTCT No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data
967826498_967826505 -5 Left 967826498 3:193881734-193881756 CCCCTCCTCACCCCACTGAGGGT No data
Right 967826505 3:193881752-193881774 AGGGTCTGAGTCTCCGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967826505 Original CRISPR AGGGTCTGAGTCTCCGTGCC AGG Intergenic
No off target data available for this crispr