ID: 967832136

View in Genome Browser
Species Human (GRCh38)
Location 3:193928714-193928736
Sequence TACATAAAGGGGAGTTTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967832136_967832143 26 Left 967832136 3:193928714-193928736 CCTAATAAACTCCCCTTTATGTA No data
Right 967832143 3:193928763-193928785 TAGAGACCCCTGACTAATACAGG No data
967832136_967832144 29 Left 967832136 3:193928714-193928736 CCTAATAAACTCCCCTTTATGTA No data
Right 967832144 3:193928766-193928788 AGACCCCTGACTAATACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967832136 Original CRISPR TACATAAAGGGGAGTTTATT AGG (reversed) Intergenic
No off target data available for this crispr