ID: 967832138

View in Genome Browser
Species Human (GRCh38)
Location 3:193928726-193928748
Sequence ACAGGACATATATACATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967832138_967832143 14 Left 967832138 3:193928726-193928748 CCCTTTATGTATATATGTCCTGT No data
Right 967832143 3:193928763-193928785 TAGAGACCCCTGACTAATACAGG No data
967832138_967832148 22 Left 967832138 3:193928726-193928748 CCCTTTATGTATATATGTCCTGT No data
Right 967832148 3:193928771-193928793 CCTGACTAATACAGGTGGTCAGG No data
967832138_967832144 17 Left 967832138 3:193928726-193928748 CCCTTTATGTATATATGTCCTGT No data
Right 967832144 3:193928766-193928788 AGACCCCTGACTAATACAGGTGG No data
967832138_967832149 26 Left 967832138 3:193928726-193928748 CCCTTTATGTATATATGTCCTGT No data
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967832138 Original CRISPR ACAGGACATATATACATAAA GGG (reversed) Intergenic