ID: 967832140

View in Genome Browser
Species Human (GRCh38)
Location 3:193928744-193928766
Sequence TCTAGAGGGACAGAACTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4246
Summary {0: 77, 1: 755, 2: 1201, 3: 1045, 4: 1168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967832140_967832143 -4 Left 967832140 3:193928744-193928766 CCTGTTAGTTCTGTCCCTCTAGA 0: 77
1: 755
2: 1201
3: 1045
4: 1168
Right 967832143 3:193928763-193928785 TAGAGACCCCTGACTAATACAGG No data
967832140_967832149 8 Left 967832140 3:193928744-193928766 CCTGTTAGTTCTGTCCCTCTAGA 0: 77
1: 755
2: 1201
3: 1045
4: 1168
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data
967832140_967832144 -1 Left 967832140 3:193928744-193928766 CCTGTTAGTTCTGTCCCTCTAGA 0: 77
1: 755
2: 1201
3: 1045
4: 1168
Right 967832144 3:193928766-193928788 AGACCCCTGACTAATACAGGTGG No data
967832140_967832148 4 Left 967832140 3:193928744-193928766 CCTGTTAGTTCTGTCCCTCTAGA 0: 77
1: 755
2: 1201
3: 1045
4: 1168
Right 967832148 3:193928771-193928793 CCTGACTAATACAGGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967832140 Original CRISPR TCTAGAGGGACAGAACTAAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr