ID: 967832141

View in Genome Browser
Species Human (GRCh38)
Location 3:193928758-193928780
Sequence ATTAGTCAGGGGTCTCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3411
Summary {0: 8, 1: 810, 2: 1148, 3: 816, 4: 629}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967832141_967832149 -6 Left 967832141 3:193928758-193928780 CCCTCTAGAGACCCCTGACTAAT 0: 8
1: 810
2: 1148
3: 816
4: 629
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data
967832141_967832148 -10 Left 967832141 3:193928758-193928780 CCCTCTAGAGACCCCTGACTAAT 0: 8
1: 810
2: 1148
3: 816
4: 629
Right 967832148 3:193928771-193928793 CCTGACTAATACAGGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967832141 Original CRISPR ATTAGTCAGGGGTCTCTAGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr