ID: 967832142

View in Genome Browser
Species Human (GRCh38)
Location 3:193928759-193928781
Sequence TATTAGTCAGGGGTCTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3507
Summary {0: 8, 1: 826, 2: 1194, 3: 887, 4: 592}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967832142_967832149 -7 Left 967832142 3:193928759-193928781 CCTCTAGAGACCCCTGACTAATA 0: 8
1: 826
2: 1194
3: 887
4: 592
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967832142 Original CRISPR TATTAGTCAGGGGTCTCTAG AGG (reversed) Intergenic
Too many off-targets to display for this crispr