ID: 967832143

View in Genome Browser
Species Human (GRCh38)
Location 3:193928763-193928785
Sequence TAGAGACCCCTGACTAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967832136_967832143 26 Left 967832136 3:193928714-193928736 CCTAATAAACTCCCCTTTATGTA No data
Right 967832143 3:193928763-193928785 TAGAGACCCCTGACTAATACAGG No data
967832138_967832143 14 Left 967832138 3:193928726-193928748 CCCTTTATGTATATATGTCCTGT No data
Right 967832143 3:193928763-193928785 TAGAGACCCCTGACTAATACAGG No data
967832139_967832143 13 Left 967832139 3:193928727-193928749 CCTTTATGTATATATGTCCTGTT No data
Right 967832143 3:193928763-193928785 TAGAGACCCCTGACTAATACAGG No data
967832140_967832143 -4 Left 967832140 3:193928744-193928766 CCTGTTAGTTCTGTCCCTCTAGA 0: 77
1: 755
2: 1201
3: 1045
4: 1168
Right 967832143 3:193928763-193928785 TAGAGACCCCTGACTAATACAGG No data
967832137_967832143 15 Left 967832137 3:193928725-193928747 CCCCTTTATGTATATATGTCCTG No data
Right 967832143 3:193928763-193928785 TAGAGACCCCTGACTAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967832143 Original CRISPR TAGAGACCCCTGACTAATAC AGG Intergenic
No off target data available for this crispr