ID: 967832149

View in Genome Browser
Species Human (GRCh38)
Location 3:193928775-193928797
Sequence ACTAATACAGGTGGTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967832141_967832149 -6 Left 967832141 3:193928758-193928780 CCCTCTAGAGACCCCTGACTAAT 0: 8
1: 810
2: 1148
3: 816
4: 629
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data
967832138_967832149 26 Left 967832138 3:193928726-193928748 CCCTTTATGTATATATGTCCTGT No data
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data
967832137_967832149 27 Left 967832137 3:193928725-193928747 CCCCTTTATGTATATATGTCCTG No data
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data
967832142_967832149 -7 Left 967832142 3:193928759-193928781 CCTCTAGAGACCCCTGACTAATA 0: 8
1: 826
2: 1194
3: 887
4: 592
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data
967832140_967832149 8 Left 967832140 3:193928744-193928766 CCTGTTAGTTCTGTCCCTCTAGA 0: 77
1: 755
2: 1201
3: 1045
4: 1168
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data
967832139_967832149 25 Left 967832139 3:193928727-193928749 CCTTTATGTATATATGTCCTGTT No data
Right 967832149 3:193928775-193928797 ACTAATACAGGTGGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967832149 Original CRISPR ACTAATACAGGTGGTCAGGA AGG Intergenic
No off target data available for this crispr