ID: 967832453

View in Genome Browser
Species Human (GRCh38)
Location 3:193932003-193932025
Sequence TGGCATGGCAGTTTTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967832453_967832458 -7 Left 967832453 3:193932003-193932025 CCTTCCCCAAAACTGCCATGCCA No data
Right 967832458 3:193932019-193932041 CATGCCATGTCACACGACTGTGG No data
967832453_967832460 4 Left 967832453 3:193932003-193932025 CCTTCCCCAAAACTGCCATGCCA No data
Right 967832460 3:193932030-193932052 ACACGACTGTGGTTTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967832453 Original CRISPR TGGCATGGCAGTTTTGGGGA AGG (reversed) Intergenic
No off target data available for this crispr