ID: 967833699

View in Genome Browser
Species Human (GRCh38)
Location 3:193943344-193943366
Sequence GCCTGTGGGCCACTTTGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967833687_967833699 25 Left 967833687 3:193943296-193943318 CCAGTGGCCAGGACTACCACGTT No data
Right 967833699 3:193943344-193943366 GCCTGTGGGCCACTTTGGGCCGG No data
967833692_967833699 1 Left 967833692 3:193943320-193943342 CCTGACACCTCGGCTCGGTGCCT No data
Right 967833699 3:193943344-193943366 GCCTGTGGGCCACTTTGGGCCGG No data
967833693_967833699 -6 Left 967833693 3:193943327-193943349 CCTCGGCTCGGTGCCTCGCCTGT No data
Right 967833699 3:193943344-193943366 GCCTGTGGGCCACTTTGGGCCGG No data
967833688_967833699 18 Left 967833688 3:193943303-193943325 CCAGGACTACCACGTTGCCTGAC No data
Right 967833699 3:193943344-193943366 GCCTGTGGGCCACTTTGGGCCGG No data
967833690_967833699 9 Left 967833690 3:193943312-193943334 CCACGTTGCCTGACACCTCGGCT No data
Right 967833699 3:193943344-193943366 GCCTGTGGGCCACTTTGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967833699 Original CRISPR GCCTGTGGGCCACTTTGGGC CGG Intergenic
No off target data available for this crispr