ID: 967839105

View in Genome Browser
Species Human (GRCh38)
Location 3:193990384-193990406
Sequence CTTTATAAGAAGAAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967839105_967839108 -3 Left 967839105 3:193990384-193990406 CCTCTCTTCTTCTTCTTATAAAG No data
Right 967839108 3:193990404-193990426 AAGCCACCAGCCACATCATGGGG No data
967839105_967839106 -5 Left 967839105 3:193990384-193990406 CCTCTCTTCTTCTTCTTATAAAG No data
Right 967839106 3:193990402-193990424 TAAAGCCACCAGCCACATCATGG No data
967839105_967839109 -2 Left 967839105 3:193990384-193990406 CCTCTCTTCTTCTTCTTATAAAG No data
Right 967839109 3:193990405-193990427 AGCCACCAGCCACATCATGGGGG No data
967839105_967839107 -4 Left 967839105 3:193990384-193990406 CCTCTCTTCTTCTTCTTATAAAG No data
Right 967839107 3:193990403-193990425 AAAGCCACCAGCCACATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967839105 Original CRISPR CTTTATAAGAAGAAGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr