ID: 967839806

View in Genome Browser
Species Human (GRCh38)
Location 3:193996209-193996231
Sequence CTCACCAGGCTGTTAGTAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967839802_967839806 -5 Left 967839802 3:193996191-193996213 CCCCACGCTCTCAGCAGGCTCAC 0: 1
1: 0
2: 0
3: 6
4: 152
Right 967839806 3:193996209-193996231 CTCACCAGGCTGTTAGTAACCGG 0: 1
1: 0
2: 0
3: 6
4: 99
967839799_967839806 7 Left 967839799 3:193996179-193996201 CCACCTTGAGAGCCCCACGCTCT 0: 1
1: 0
2: 0
3: 19
4: 161
Right 967839806 3:193996209-193996231 CTCACCAGGCTGTTAGTAACCGG 0: 1
1: 0
2: 0
3: 6
4: 99
967839800_967839806 4 Left 967839800 3:193996182-193996204 CCTTGAGAGCCCCACGCTCTCAG 0: 1
1: 0
2: 1
3: 13
4: 265
Right 967839806 3:193996209-193996231 CTCACCAGGCTGTTAGTAACCGG 0: 1
1: 0
2: 0
3: 6
4: 99
967839804_967839806 -7 Left 967839804 3:193996193-193996215 CCACGCTCTCAGCAGGCTCACCA 0: 1
1: 0
2: 1
3: 12
4: 224
Right 967839806 3:193996209-193996231 CTCACCAGGCTGTTAGTAACCGG 0: 1
1: 0
2: 0
3: 6
4: 99
967839798_967839806 8 Left 967839798 3:193996178-193996200 CCCACCTTGAGAGCCCCACGCTC 0: 1
1: 0
2: 0
3: 27
4: 199
Right 967839806 3:193996209-193996231 CTCACCAGGCTGTTAGTAACCGG 0: 1
1: 0
2: 0
3: 6
4: 99
967839803_967839806 -6 Left 967839803 3:193996192-193996214 CCCACGCTCTCAGCAGGCTCACC 0: 1
1: 0
2: 0
3: 12
4: 113
Right 967839806 3:193996209-193996231 CTCACCAGGCTGTTAGTAACCGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967839806 Original CRISPR CTCACCAGGCTGTTAGTAAC CGG Intergenic
907803359 1:57793799-57793821 ATCACTAGGCTTTTAGTAAGAGG + Intronic
912734630 1:112139393-112139415 GTCACTAGGCTGTGAGCAACAGG + Intergenic
912810314 1:112789367-112789389 CTCAACAGGCTATAAATAACAGG - Intergenic
917337857 1:173943601-173943623 TGCACTAGGCTGTTAGTAACAGG - Exonic
917494826 1:175530914-175530936 CTCACAAGGCTCTCAGTAAATGG - Intronic
919644467 1:200080027-200080049 CTCCCCAGGCTTTTAGCAAATGG + Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1063346884 10:5319883-5319905 CTCACCAGGGTTTGGGTAACAGG - Intergenic
1067922569 10:50475528-50475550 CTCATCAGGCTATGAATAACTGG + Intronic
1070280195 10:75043193-75043215 CTCACGAGGCTGAGTGTAACTGG + Intronic
1071218398 10:83433928-83433950 CTCACCAGGATGTGAGAAGCTGG + Intergenic
1071478351 10:86043490-86043512 ATCACCAGGCTGCCAGCAACAGG - Intronic
1080911147 11:36600311-36600333 GTCAGCAGTCTGTTAGGAACAGG + Intronic
1081820003 11:45983577-45983599 CTCACCTGGCTTTCAGTTACTGG - Intronic
1083540999 11:63511448-63511470 CCCACCAGCCTGTGAGCAACTGG - Intronic
1084220183 11:67673280-67673302 CTCACCAGGCAGTTCCTGACTGG + Intronic
1089137733 11:116263135-116263157 TTCACCAGGCTGCTAGTACCAGG - Intergenic
1089192471 11:116662962-116662984 CTCATCAGGCTGTTGGGCACAGG + Intergenic
1089404347 11:118185174-118185196 CTCACCTGTCTGTTGGTAATTGG - Intergenic
1090632778 11:128664721-128664743 CTCACTAGGCTGCTAGTCTCTGG + Intergenic
1093168737 12:15835506-15835528 GTCAGTAGTCTGTTAGTAACCGG + Intronic
1096489227 12:52004742-52004764 CTCCACAGGCTGTTAGACACAGG + Intergenic
1097612303 12:61839131-61839153 CTCACCAGACTGTAAGTTCCTGG - Intronic
1102422149 12:112812289-112812311 CAAACCAGGGTGTTAGTACCAGG + Intronic
1104047151 12:125171527-125171549 CTCACGAGGCTGTAATTAAGGGG + Intergenic
1108121954 13:47197732-47197754 CTCACCAGGCTGTTTGTCCATGG + Intergenic
1113909473 13:113835368-113835390 ATTACCAGGCTGATAGAAACAGG + Intronic
1114258550 14:21022017-21022039 TTCACCAGACTGTGAGGAACAGG - Intronic
1114485809 14:23061079-23061101 CTCACCTGGCTGTCAGTCAGTGG + Exonic
1121496382 14:94394330-94394352 ATCACCAGGCTGCAAGTAACCGG + Intergenic
1121880649 14:97497671-97497693 CCCACCAGGCTGTAAGCAATTGG - Intergenic
1123785076 15:23663445-23663467 CTCTCCAGGCTGTTAGTGAAGGG - Intergenic
1123888082 15:24747899-24747921 CTCACCAAGCTGGAAATAACGGG - Intergenic
1126097612 15:45100527-45100549 CTCAACAGGATGATAGTAAGGGG - Intronic
1127796707 15:62444572-62444594 AGCACAAGGCTGTTAGTAACTGG + Intronic
1138199265 16:55077070-55077092 GTCACCTGGCTGGTAGGAACTGG - Intergenic
1142565930 17:840311-840333 CACACCAGGCTGAGAGTAACCGG - Intronic
1143086083 17:4417096-4417118 CTCACCAGCCTGGGAGTAATAGG - Intergenic
1151134726 17:71935232-71935254 GTCACCAGGCTGTTAATGAGAGG - Intergenic
1160541784 18:79627917-79627939 CTCTCCAGGCTGTTGGAGACAGG - Intergenic
1161279644 19:3438841-3438863 CTCACTAGGCTGTTAGCCCCTGG - Intronic
1164872294 19:31656237-31656259 CTCACGATGCTGTTAGGGACGGG + Intergenic
1164912067 19:32020968-32020990 TTCACCAGGCTGTGGGAAACTGG + Intergenic
1168324833 19:55533007-55533029 CTCACAAGGCCGTGTGTAACTGG + Intronic
1168636172 19:57999161-57999183 CTCACCAGGCTGTGCCCAACTGG + Intronic
935234431 2:101126511-101126533 TTTGCCAGGCTGTTGGTAACAGG - Intronic
935691757 2:105738221-105738243 ATGACTAGGCTGTAAGTAACTGG + Intergenic
936015393 2:108955009-108955031 CCCACCAGGCTATGAGTGACTGG + Intronic
938401709 2:130998315-130998337 CTAACCAAGATGTTAATAACTGG - Intronic
942114732 2:172717056-172717078 CTCCACAGGCTGTGAATAACAGG - Intergenic
943435812 2:187865222-187865244 CCCTCCTTGCTGTTAGTAACTGG + Intergenic
946210647 2:218144556-218144578 CACACCCGGCTGTTGGGAACAGG + Intergenic
947101292 2:226623939-226623961 CTCACCAGACCTTTAGTAATTGG + Intergenic
947126881 2:226878567-226878589 GTCACCAGGCTGTGAGGAAGAGG + Intronic
1169187444 20:3630589-3630611 CTCACCAGGCTGTACGTACTTGG - Intronic
1172382423 20:34506422-34506444 GTCCCCAGCCTGTTAGGAACTGG + Intronic
1176968913 21:15243500-15243522 TCCACCAGGCTGTGAGAAACCGG - Intergenic
1179957428 21:44749410-44749432 CTCACCTGGCTGTGAGCCACAGG + Intergenic
1181624326 22:24113072-24113094 CACACCTGGCTTTTACTAACAGG + Intronic
1183214291 22:36469111-36469133 CTCACCTGGCTGGTAGGAGCCGG - Intronic
950456471 3:13095647-13095669 ATCACCAGCCTTTTAGGAACTGG + Intergenic
951026938 3:17840607-17840629 CTCCCCAGGCTGATACTAGCTGG + Intronic
951044404 3:18022349-18022371 CTCACCAGGCTGCAATTAAGAGG - Intronic
955426737 3:58799131-58799153 CTCACCAGGCTAATAGAATCTGG - Intronic
958193528 3:90213151-90213173 TTTGCTAGGCTGTTAGTAACAGG - Intergenic
960031688 3:113060546-113060568 CACTCCAGGCTGTTCCTAACTGG - Intergenic
960336586 3:116425179-116425201 CTCACTATGCTGTTCGTTACAGG - Intronic
967839806 3:193996209-193996231 CTCACCAGGCTGTTAGTAACCGG + Intergenic
969601130 4:8177025-8177047 CTCTCCAGGCTGACACTAACTGG + Intergenic
973320468 4:48805313-48805335 CTTACCAGGCTGTGATTAAGAGG - Intronic
973775228 4:54235596-54235618 CACACCAGGCTGGAGGTAACAGG + Intronic
973777031 4:54253059-54253081 CACACCAGGCTGGAGGTAACAGG + Intronic
973902162 4:55486853-55486875 CTCAACAGGCTTTTCCTAACTGG + Intronic
974571116 4:63650022-63650044 CTTTCAAGGCTGTTAGTATCAGG + Intergenic
986097487 5:4573970-4573992 CCCACCAGGCTGTTTTTAAGTGG + Intergenic
986787026 5:11123886-11123908 CTCCCCAGGCTCTTCCTAACAGG + Intronic
986883494 5:12205281-12205303 CTCTCCAGGCTTTTGGTATCAGG + Intergenic
991016180 5:61935037-61935059 CTCACCAGGTTGTTTCTAAAGGG + Intergenic
991095993 5:62740091-62740113 CTTACCAGGAAGTTAATAACAGG - Intergenic
993342152 5:86738283-86738305 CAGACCAGCCTGTTAGGAACAGG - Intergenic
998196841 5:140080828-140080850 CTCACATGGCTGTTAGTAGAAGG - Intergenic
998306232 5:141079765-141079787 CCCACCAGACTTTTAGTAATTGG - Intergenic
998812215 5:145977651-145977673 CTCAGCAAGCTGATAGTAATAGG - Intronic
1003957371 6:11176404-11176426 CTCACCAGGGTCTTCATAACGGG - Intergenic
1013068039 6:106702757-106702779 CACTCCAGTCTGTTAGAAACAGG + Intergenic
1017695354 6:157009327-157009349 CGCACAAGGCTGTTAGTATGAGG + Intronic
1019670479 7:2275335-2275357 CTCACCAGGCCTTTACTAAATGG + Intronic
1028653791 7:93179150-93179172 CGCACCAGTGTGTTAGGAACTGG - Intergenic
1030685457 7:112482053-112482075 CTCATGAGGCTGCTAGTAAAGGG - Intronic
1032766942 7:135003197-135003219 CTCACCAGGCATTTAATAATAGG - Intronic
1032983832 7:137315666-137315688 CACAGCAGGCTGTCAGTAAGGGG - Intronic
1039836737 8:41262344-41262366 CTCATCAGACTCTGAGTAACTGG - Exonic
1041224612 8:55685903-55685925 CACTCCAAGCTGTTAGTAAAAGG - Intergenic
1048140779 8:131792108-131792130 CACAGCAGGCTCTTAGTAAATGG - Intergenic
1055469259 9:76595161-76595183 CTCCCCAGGATGTTATCAACTGG - Intergenic
1058578471 9:106429197-106429219 CTAACCTGGCTGTTTATAACTGG - Intergenic
1058578542 9:106429940-106429962 CTAACCTGGCTGTTTATAACTGG + Intergenic
1059588196 9:115628741-115628763 AACACCAGGCTGTTAACAACTGG + Intergenic
1062180995 9:135191213-135191235 CTCACCTGGCTGTTGGGAAAAGG + Intergenic
1185712533 X:2315457-2315479 CTCACCAGGCAGCAAGAAACAGG - Intronic
1185728185 X:2439902-2439924 GTCCCCAGCCTTTTAGTAACTGG - Intronic
1186547308 X:10464012-10464034 CTCACCGGGTTGTTTGTATCAGG - Intronic
1190842465 X:54158153-54158175 CTCATTAGGCAGTTAGTAATTGG - Intronic
1194918447 X:99733520-99733542 CTAACCAGGCTGTGAATAAAAGG - Intergenic
1200971231 Y:9154605-9154627 CTCATCAGGCTGTTAGCACAAGG + Intergenic
1202139791 Y:21709693-21709715 CTCATCAGGCTGTTAGCACAAGG - Intergenic