ID: 967844534

View in Genome Browser
Species Human (GRCh38)
Location 3:194033279-194033301
Sequence TTGGCCAAACACACCCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967844526_967844534 24 Left 967844526 3:194033232-194033254 CCTCTGGTGAGCATTTTCATCTG No data
Right 967844534 3:194033279-194033301 TTGGCCAAACACACCCAACCAGG No data
967844529_967844534 -8 Left 967844529 3:194033264-194033286 CCGCCTCCTGCCACCTTGGCCAA No data
Right 967844534 3:194033279-194033301 TTGGCCAAACACACCCAACCAGG No data
967844525_967844534 29 Left 967844525 3:194033227-194033249 CCAGGCCTCTGGTGAGCATTTTC No data
Right 967844534 3:194033279-194033301 TTGGCCAAACACACCCAACCAGG No data
967844527_967844534 -1 Left 967844527 3:194033257-194033279 CCTTAATCCGCCTCCTGCCACCT No data
Right 967844534 3:194033279-194033301 TTGGCCAAACACACCCAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967844534 Original CRISPR TTGGCCAAACACACCCAACC AGG Intergenic
No off target data available for this crispr