ID: 967844701

View in Genome Browser
Species Human (GRCh38)
Location 3:194034465-194034487
Sequence CAGTGGTTCTTAAAGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967844701_967844709 25 Left 967844701 3:194034465-194034487 CCAAGACACTTTAAGAACCACTG No data
Right 967844709 3:194034513-194034535 AGTTTCAGATTTGAATCACTTGG No data
967844701_967844706 1 Left 967844701 3:194034465-194034487 CCAAGACACTTTAAGAACCACTG No data
Right 967844706 3:194034489-194034511 GCTAGGCAAAGGGAAATCCCAGG No data
967844701_967844703 -10 Left 967844701 3:194034465-194034487 CCAAGACACTTTAAGAACCACTG No data
Right 967844703 3:194034478-194034500 AGAACCACTGTGCTAGGCAAAGG No data
967844701_967844704 -9 Left 967844701 3:194034465-194034487 CCAAGACACTTTAAGAACCACTG No data
Right 967844704 3:194034479-194034501 GAACCACTGTGCTAGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967844701 Original CRISPR CAGTGGTTCTTAAAGTGTCT TGG (reversed) Intergenic
No off target data available for this crispr