ID: 967845979

View in Genome Browser
Species Human (GRCh38)
Location 3:194043105-194043127
Sequence TAAGTGGGAGGTCAGCCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967845979_967845985 25 Left 967845979 3:194043105-194043127 CCGTGAGGCTGACCTCCCACTTA No data
Right 967845985 3:194043153-194043175 TTCATGAGGATTGTTTGCTGTGG No data
967845979_967845986 26 Left 967845979 3:194043105-194043127 CCGTGAGGCTGACCTCCCACTTA No data
Right 967845986 3:194043154-194043176 TCATGAGGATTGTTTGCTGTGGG No data
967845979_967845984 11 Left 967845979 3:194043105-194043127 CCGTGAGGCTGACCTCCCACTTA No data
Right 967845984 3:194043139-194043161 GAGCTGAGCTGTATTTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967845979 Original CRISPR TAAGTGGGAGGTCAGCCTCA CGG (reversed) Intergenic
No off target data available for this crispr