ID: 967846795

View in Genome Browser
Species Human (GRCh38)
Location 3:194050309-194050331
Sequence AGTAGTAATTCTATCAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967846795_967846796 -8 Left 967846795 3:194050309-194050331 CCAGTCTTGATAGAATTACTACT No data
Right 967846796 3:194050324-194050346 TTACTACTGTTCTCAGACATTGG No data
967846795_967846797 -7 Left 967846795 3:194050309-194050331 CCAGTCTTGATAGAATTACTACT No data
Right 967846797 3:194050325-194050347 TACTACTGTTCTCAGACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967846795 Original CRISPR AGTAGTAATTCTATCAAGAC TGG (reversed) Intergenic
No off target data available for this crispr