ID: 967846796

View in Genome Browser
Species Human (GRCh38)
Location 3:194050324-194050346
Sequence TTACTACTGTTCTCAGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967846795_967846796 -8 Left 967846795 3:194050309-194050331 CCAGTCTTGATAGAATTACTACT No data
Right 967846796 3:194050324-194050346 TTACTACTGTTCTCAGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967846796 Original CRISPR TTACTACTGTTCTCAGACAT TGG Intergenic
No off target data available for this crispr